fbpx

Covid 19 – Dokaz svjetske prevare

Covid 19

Čini se da su COVID 19 kao i kasnije reakcije vlada dio međunarodne zavjere za počinjenje prijevare. Čini se da nema dokaza da virus nazvan SARS-CoV-2 uzrokuje bolest zvanu COVID 19.

Ponekad morate imati žicu. Nisam stručnjak za genetiku i, kao i uvijek, toleriram ispravke. No moju su pažnju privukla neka istraživanja objavljena u španjolskom medicinskom časopisu D-Salud-Discovery. Njihov savjetodavni odbor visoko kvalificiranih liječnika i znanstvenika daje dodatnu vjerodostojnost njihovim istraživanjima. Njihova je tvrdnja zapanjujuća.

Genetski primeri i sonde korišteni u RT-PCR testovima za identifikaciju SARS-CoV-2 ne ciljaju ništa određeno. Slijedio sam tehnike pretraživanja navedene u ovom engleskom prijevodu njihovog izvještaja i mogu potvrditi točnost njihovih tvrdnji o nukleotidnim sekvencama navedenim u protokolima Svjetske zdravstvene organizacije. Možete i vi učiniti isto.

D-Salud-Discovery tvrdi da ne postoje testovi koji bi mogli identificirati SARS-CoV-2. Slijedom toga, sve su tvrdnje o navodnom utjecaju COVID 19 na zdravlje stanovništva neutemeljene.

Cjelokupna službena pripovijest o COVIDU 19 je obmana. Navodno, ne postoji znanstveni temelj ni za jedan njegov dio.

Ako su ove tvrdnje točne, možemo ustvrditi da ne postoje dokazi o pandemiji, već samo privid jedne. Trpjeli smo nesagledivi gubitak bez ikakvog očitog razloga, osim ambicija beskrupuloznih despota koji žele transformirati globalno gospodarstvo i naše društvo u skladu sa svojim svrhama.

Pritom je ova “parazitska klasa” potencijalno počinila bezbroj zločina. Ti se zločini mogu i trebaju istražiti i procesuirati na sudu.

IDENTIFIKACIJA ČEGA TOČNO?

Svjetska zdravstvena organizacija (WHO) klasificirala je COVID-19 (COronaVIrus Disease 2019). Proglasili su globalnu pandemiju COVID 19 11. ožujka 2019.

Covid 19 – Dokaz svjetske prevare 1

Smjernice laboratorijskog ispitivanja SZO-a navode:

„Etiološki uzročnik [uzročnik bolesti] odgovoran za klaster slučajeva upale pluća u Wuhanu identificiran je kao novi betakoronavirus, (u istoj obitelji kao SARS-CoV i MERS-CoV) putem sekvenciranja sljedeće generacije (NGS) iz uzgajanog virusa ili izravno iz uzoraka primljenih od nekoliko oboljelih od upale pluća.”

Tvrdnja SZO-a je da virus SARS-CoV-2 uzrokuje bolest COVID-19. Također tvrde da su istraživači iz Wuhana jasno identificirali ovaj virus.

U WHO-ovom izvještaju Novel Coronavirus 9-nCov Situation Report1, navode:

Kineske vlasti identificirale su novu vrstu koronavirusa, koji je izoliran 7. siječnja 2020.…. 12. siječnja 2020. Kina je podijelila genetski slijed novog koronavirusa zemljama koje će ga koristiti u razvoju specifičnih dijagnostičkih kompleta.”

Ove dvije izjave SZO-a jasno sugeriraju da je virus SARS-CoV-2 izoliran (što znači pročišćen za proučavanje), a zatim su identificirane genetske sekvence iz izoliranog uzorka. Od toga su razvijeni dijagnostički kompleti koji su globalno distribuirani za testiranje virusa u gradovima i zajednicama širom svijeta. Prema WHO-u i kineskim istraživačima, ovim će se testovima pronaći virus koji uzrokuje COVID 19.

Ipak, SZO također navodi:

„Radeći izravno iz informacija o sekvencama, tim je razvio niz testova genetske amplifikacije (PCR) koje koriste laboratoriji.”

Znanstvenici iz Wuhana razvili su svoje testove genetske amplifikacije iz “informacija o sekvencama” jer nije bilo izoliranog, pročišćenog uzorka takozvanog virusa SARS-CoV-2. Također su pokazali slike elektronskog mikroskopa novootkrivenih viriona (šiljasta proteinska kugla koja sadrži virusnu RNA.)

Međutim, takve proteinske strukture nisu jedinstvene. Izgledaju poput ostalih okruglih vezikula, poput endocitnih mjehurića i egzozoma.

Covid 19 – Dokaz svjetske prevare 2

Virolozi tvrde da nije moguće “izolirati” virus jer se on replicira samo unutar stanica domaćina. Dodaju da se Kochovi postulati ne primjenjuju jer se odnose na bakterije (koje su živi organizmi). Umjesto toga, virolozi promatraju citopatogene učinke virusa (CPE), uzrokujući mutaciju i razgradnju stanica u staničnim kulturama.

Kada su kineski istraživači prvi put sekvencirali puni genom SARS-CoV-2, primijetili su CPE u stanicama Vero E6 i Huh7. Vero E6 su ovjekovječene stanice majmuna, a Huh7 su ovjekovječene stanice raka (tumorske). Što znači da se održavaju in vitro (u kulturama Petrijevih zdjelica) dugi niz godina.

Za službenu priču o SARS-CoV-2 središnja je ideja da je to zoonotski virus, sposoban premostiti jaz između vrsta i životinja. Kad su znanstvenici iz američkog CDC-a “zarazili” nove stanice novim virusom, primijetili su sljedeće:

Ispitali smo sposobnost SARS-CoV-2 da zarazi i umnoži se u nekoliko zajedničkih linija primata i ljudskih stanica, uključujući stanice ljudskog adenokarcinoma (A549) [plućne stanice], stanice ljudske jetre (HUH7.0) i stanice ljudskog embrija ( HEK-293T), uz Vero E6 i Vero CCL81 [stanice majmuna] … Nije primijećen citopatski učinak ni u jednoj staničnoj liniji, osim u Vero stanicama [stanice majmuna] … Stanice HUH7.0 i 293T pokazale su samo skromnu virusnu replikaciju i Stanice A549 [stanice ljudskog plućnog tkiva] bile su nespojive s infekcijom SARS-CoV-2.”

CDC nije primijetio CPE u ljudskim stanicama. Nisu vidjeli dokaze da je ovaj navodni virus prouzročio bilo kakvu ljudsku bolest. Niti ovaj navodni ljudski virus nije pokazao značajnu replikaciju u ljudskim stanicama, što sugerira da bi infekcija od čovjeka do čovjeka bila nemoguća.

Primijetivši ovaj problem, tim poljskih znanstvenika uveo je ovaj sekvencionirani “virus” u stanice ljudskog epitela (dišnih putova). Promatrali su učinke na ove HAE kulture tijekom 5 dana. Primijetili su mnogo veću reprodukciju od znanstvenika CDC-a, ali na kraju su izjavili:

“Nismo primijetili nikakvo oslobađanje virusa s bazolateralne strane HAE kulture.”

Što znači da nisu vidjeli nikakve dokaze da su navodni virioni probili membranu staničnog zida. Opet sugerirajući da ovaj takozvani virus nije zarazan za ljude.

Nije jasno da li je SARS-CoV-2 ljudski virus koji može uzrokovati bolest. Možda čak i fizički ne postoji. Nije li to ništa drugo do koncept zasnovan na prediktivnim genetskim sekvencama?

covid19 struktura

PUT DO OTKRIĆA

Centar za kontrolu i prevenciju bolesti Wuhan i Klinički centar za javno zdravstvo u Šangaju objavili su prvi cjeloviti genom SARS-CoV-2 (MN908947.1). Ovo je mnogo puta ažurirano. Međutim, MN908947.1 je prva genetska sekvenca koja opisuje navodni etiološki agens COVID 19 (SARS-CoV-2).

Svi sljedeći zahtjevi, ispitivanja, liječenja, statistika, razvoj cjepiva i politike koje su rezultirale iz toga, temelje se na ovom slijedu. Ako testovi za ovaj novi virus ne identificiraju ništa što bi moglo izazvati bolest kod ljudi, cijela pripovijest o COVIDU 19 nije ništa drugo do šarada.

Istraživači WUHANA izjavili su da su učinkovito spojili genetsku sekvencu SARS-CoV-2 poklapajući fragmente pronađene u uzorcima s drugim, prethodno otkrivenim genetskim sekvencama. Od prikupljenog materijala pronašli su 87,1 % podudaranja sa SARS koronavirusom (SARS-Cov). Koristili su de novo sklop i ciljani PCR i pronašli 29.891-bazni par koji dijeli 79,6 % podudaranja sekvence sa SARS-CoV.

Morali su se koristiti de novo sklopom jer nisu imali apriorno znanje o ispravnom slijedu ili redoslijedu tih fragmenata. Jednostavno, izjava SZO-a da su kineski istraživači izolirali virus 7. siječnja je lažna.

Tim iz Wuhana upotrijebio je 40 rundi RT-qPCR amplifikacije kako bi uskladio fragmente cDNA (komplementarna DNA izrađene od uzorkovanih fragmenata RNA) s objavljenim genomom koronavirusa SARS (SARS-CoV). Nažalost, nije jasno ni koliko je točan izvorni SARS-CoV genom.

2003. godine tim istraživača iz Hong Konga proučavao je 50 pacijenata s teškim akutnim respiratornim sindromom (SARS). Uzeli su uzorke od 2 pacijenta i razvili kulturu u stanicama jetre fetusa majmuna.

Stvorili su 30 klonova genetskog materijala koji su pronašli. Nisu uspjeli pronaći dokaze ni o jednom drugom poznatom virusu, u samo jednom od ovih kloniranih uzoraka pronašli su genetske sekvence “nepoznatog podrijetla”.

Covid 19 – Dokaz svjetske prevare 3

Ispitujući ove nepoznate sekvence RNA, utvrdili su da se 57% podudara s goveđim koronavirusom i virusom mišjeg hepatitisa i zaključili su da je iz obitelji Coronaviridae. S obzirom na to da ove sekvence sugeriraju novootkriveni virus SARS-CoV (nova otkrića su ambrozija (piće bogova) za znanstvenike), dizajnirali su RT-PCR početnice za testiranje na ovaj novi virus. Istraživači su izjavili:

„Primeri za otkrivanje novog virusa dizajnirani su za RT-PCR detekciju ovog genoma koronavirusa povezanog s upalom pluća u kliničkim uzorcima. Od 44 uzorka nazofarinksa dostupnih od 50 pacijenata sa SARS-om, 22 je imalo dokaze o koronavirusnoj RNA povezanoj s ljudskom upalom pluća. “

Polovica testiranih pacijenata, koji su svi imali iste simptome, bila je pozitivna na ovaj novi navodni virus. Nitko ne zna zašto je druga polovica testirana negativno na ovaj novi virus SARS-CoV. Pitanje nije postavljeno.

Ovaj navodni virus imao je samo 57% podudaranja sekvence s navodno poznatim koronavirusom. Ostalih 43% bilo je samo “tamo”. Sekvencirani podaci proizvedeni su i zabilježeni kao novi genom kao GenBank pristupni broj AY274119.

Istraživači iz Wuhana naknadno su pronašli 79,6% podudaranja sekvence s AY274119 i stoga su ga nazvali novim sojem SARS-CoV (2019-nCoV – na kraju preimenovan u SARS-CoV-2). Nitko ni u jednoj fazi ovog postupka nije proizveo izolirani, pročišćeni uzorak bilo kojeg virusa. Sve što su imali bila su postotna podudaranja niza s ostalim postotnim podudaranjima.

IZOLIRAJ NIŠTA

Znanstvenike jako nervira jer neprestano govore da je virus izoliran, ali im nitko ne vjeruje. To je zato što još uvijek nitko nije pružio niti jedan pročišćeni uzorak virusa SARS-CoV-2. Umjesto toga imamo dovršeni genom i, kao što ćemo tek otkriti, nije osobito uvjerljiv.

Novinari istražitelji Torsten Engelbrecht i Konstantin Demeter zamolili su neke znanstvenike koji su rekli da imaju slike viriona SARS-C0V-2 da potvrde da se radi o slikama izoliranog, pročišćenog virusa. Nitko od njih nije mogao.

U Australiji su znanstvenici s Instituta Doherty objavili da su izolirali virus SARS-CoV-2. Na pitanje da pojasne, znanstvenici su rekli:

“Imamo kratke (RNA) sekvence iz dijagnostičkog testa koje se mogu koristiti u dijagnostičkim testovima”

To objašnjava zašto australska vlada navodi:

„Pouzdanost testova na COVID-19 je neizvjesna zbog ograničene baze dokaza … Dostupni su ograničeni dokazi za procjenu točnosti i kliničke korisnosti dostupnih testova na COVID-19. “

U Velikoj Britaniji, u srpnju, grupa zabrinutih akademika napisala je pismo britanskom premijeru Borisu Johnsonu u kojem su ga zamolili da:

„da izraditi neovisne stručne recenzije znanstvenih dokaza koji dokazuju da je virus Covid-19 izoliran.”

Do danas nisu dobili odgovor.

Slično tome, britanski istraživač Andrew Johnson podnio je zahtjev za pristup informacijama za javno zdravstvo Engleske (PHE). Zamolio ih je da mu dostave svoje zapise koji opisuju izolaciju virusa SARS-COV-2. Na što su oni odgovorili:

„PHE može potvrditi da ne sadrži podatke na način predložen vašim zahtjevom.“

Kanadska istraživačica Christine Massey podnijela je sličan zahtjev za slobodom informacija tražeći isto od kanadske vlade. Na što je kanadska vlada odgovorila:

„Nakon temeljite pretrage sa žaljenjem vas obavještavamo da nismo uspjeli pronaći nijedan zapis koji odgovara vašem zahtjevu.“

U SAD-u Centar za kontrolu bolesti (CDC) RT-PCR Dijagnostički panel navodi:

„… Trenutno nisu dostupni kvantificirani izolati virusa 2019-nCoV …… .. Otkrivanje virusne RNA možda ne ukazuje na prisutnost zaraznog virusa ili da je 2019-nCoV uzročnik kliničkih simptoma.”

Posljednje ažuriranje 13. srpnja 2020. godine, CDC tek treba dobiti bilo koji čisti virusni uzorak od bilo kojeg pacijenta za kojeg se kaže da ima bolest COVID-19. Otvoreno priznaju da njihovi testovi ne pokazuju nužno je li SARS-CoV-2 prisutan ili uzrokuje COVID 19.

Kažu nam da ništa od toga nije važno. Da smo neuki i jednostavno ne razumijemo virologiju. Stoga moramo prihvatiti slike stvari za koje znamo da bi mogle biti nešto drugo i genetske sekvence (koje bi mogle biti bilo što drugo) kao konačni dokaz da su ovaj virus i bolest koju bi trebao uzrokovati stvarni.

Covid 19 – Dokaz svjetske prevare 4

TESTIRANJE NIČEGA

SZO i svaka vlada, think tank, odbor za upravljanje politikama, vladin znanstveni savjetnik, nadnacionalne institucije i drugi koji promoviraju službenu pripovijest o COVID 19, tvrde da SARS-CoV-2 uzrokuje COVID 19.

Iako nitko nikada nije proizveo uzorak ovog navodnog virusa, objavljen je navodni genom SARS-CoV-2. U javnosti je.

Kaže se da ključne genetske sekvence u genomu SARS-CoV-2 imaju specifične funkcije. To su ciljani proteini na koje znanstvenici testiraju kako bi identificirali prisutnost “virusa”. To uključuje:

  • Gen za RNA-polimerazu (Rd-Rp) – To omogućuje SARS-CoV-2 RNA da se replicira unutar citoplazme epitelnih stanica oboljelih od COVID 19.
  • S gen (Orf2) – ovaj glikoprotein tvori šiljak na površini viriona SARS-CoV-2 što navodno olakšava vezivanje SARS-CoV-2 za ACE2 receptore na stanicama, omogućujući RNK unutar proteinske ljuske viriona (kapsida) da pređe u sada zaraženu
  • E gen (Orf1ab) – mali membranski protein koji se koristi u sastavljanju virusa
  • N gen (Orf9a) – nukleokapsidni gen koji veže RNA u formaciju kapside

SZO održava javno dostupnu evidenciju RT-PCR primera i sondi korištenih za ispitivanje SARS-CoV-2. Primeri su specifične nukleotidne sekvence koje se vežu na antisense i osjetne niti sintetizirane cDNA.

Niti cDNA razdvajaju se pri zagrijavanju i reformiraju kad se hlade. Prije hlađenja, nukleotidne sekvence nazvane probe uvode se u kaljenja na specifična ciljna područja sumnjivog virusnog genoma. Tijekom pojačavanja, kako se područja između početnih slojeva izdužuju, kada primer udari u probu, proba propada oslobađajući fluorescentnu boju ili boju koju istraživači mogu pročitati.

Identifikacija ovih markera je ono za što znanstvenici tvrde da dokazuje prisutnost SARS-CoV-2 u uzorku.

Nešto drugo što je javno dostupno je Osnovni alat za pretraživanje lokalnog usklađivanja (BLAST). To omogućuje svima da uspoređuju objavljene nukleotidne sekvence sa svim onima koje pohranjuje genetska baza podataka Nacionalnog instituta za zdravlje (NIH) pod nazivom GenBank. Stoga možemo BLASTIRATI navodne SARS-CoV-2 početnice, sonde i ciljne sekvence gena.

SZO-ovi protokoli za nizvodne i uzvodne primere i probe, za navodni virusni genom SARS-CoV-2, temelje se na profilima gena RdRp, Orf1, N i E. Svatko ih može provući kroz BLAST da vidi što smo pronašli.

Vitalna RdRP nukleotidna sekvenca, koja se koristi kao primer, je – ATGAGCTTAGTCCTGTTG. Ako pokrenemo nukleotidni BLAST, to se bilježi kao potpuni izolat SARS-CoV-2 sa 100% podudarnim identitetom sekvence. Slično tome, uzvodna sekvenca početnog gena E primera – ATATTGCAGCAGTACGCACACA – otkriva prisutnost sekvence Orf1ab koja također identificira SARS-CoV-2.

Međutim, BLAST nam također omogućuje pretragu nukleotidnih sekvenci mikrobnih i ljudskih genoma. Ako pretražimo RdRp SARS-CoV-2 sekvencu, otkriva se 99 ljudskih kromosoma sa 100% podudaranjem identiteta sekvence. Orf1ab (E gen) vraća 90 sa 100% podudaranjem identiteta sekvence na ljudske kromosome.

Radeći isto za ove sekvence mikrobiološkom pretragom, pronalazi se 92 mikroba sa 100% podudaranjem s genom SARS-CoV-2 E i 100 podudarnih mikroba, sa 100% identitetom sekvence, vitalnim SARS-CoV-2 RdRp genom.

Kad god provjerimo takozvane jedinstvene genetske markere za SARS-CoV-2, zabilježene u protokolima SZO, nalazimo potpuno ili visoko postotno podudaranje s raznim fragmentima ljudskog genoma. To sugerira da genetske sekvence koje bi trebale identificirati SARS-CoV-2 nisu jedinstvene. Oni mogu biti bilo što, od mikrobnih sekvenci do fragmenata ljudskih kromosoma.

Takozvani provjeravači činjenica, poput Reutersova projekta Health Feedback, brzo su odbacili tvrdnje onih koji su primijetili očigledan nedostatak specifičnosti u navodnom genomu SARS-CoV-2.

Koristeći mnoštvo izvrnutih argumenata poput: “ova tvrdnja sugerira da bi svaki test trebao biti pozitivan” (što nije istina) njihov pokušaj diskreditiranja ide otprilike ovako:

„Primeri su dizajnirani da se vežu za specifične nukleotidne sekvence koje su jedinstvene za virus. Nizvodni primer se može vezati za određeni kromosom, ali uzvodni primer ne veže se za isti kromosom, pa kromosom nije prisutan u virusu SARS-CoV-2. Štoviše, budući da nizvodni i uzvodni primeri obavijaju sekvencu koji se pojačava, cDMA sekvenca između primera jedinstvena je za virus.“

Čini se da ovo namjerno pogrešno predstavlja značaj ovih nalaza iznoseći argument koji nitko, osim samih provjeravatelja činjenica, ne iznosi. BLAST pretraživanja pokazuju da ove ciljne sekvence nisu jedinstvene za SARS-CoV-2. Niti je potrebno pronaći sve ciljeve da bi se rezultat smatrao pozitivnim.

Marokanski istraživači istraživali su epidemiologiju marokanskih navodnih slučajeva SARS-CoV-2. Devet posto bilo je pozitivno za tri gena, osamnaest posto bilo je pozitivno za dva gena, a sedamdeset i tri posto za samo jedan. Kao što smo upravo razgovarali, mnogi su možda bili pozitivni ni za jednog.

To je u potpunosti u skladu sa smjernicama SZO-a za ispitivanje. Oni navode:

„Optimalna dijagnoza sastoji se od NAAT [test pojačavanja nukleinske kiseline] s najmanje dva cilja neovisna o genomu SARS-CoV-2; međutim, u područjima gdje je prijenos široko rasprostranjen, može se koristiti jednostavni algoritam s jednim ciljem …… Jedan ili više negativnih rezultata ne isključuju nužno infekciju SARS-CoV-2. ”

Bez obzira na lažne argumente dobro financiranih provjeravatelja činjenica, ako nizvodni i uzvodni primeri identificiraju smeće, možda je jedno fragment kromosoma, a drugo mikrobna sekvenca, onda je i pojačano područje između njih vjerojatno smeće.

Argument da RT-PCR pronalazi samo RNA je nepresušan. Prirodna transkripcija (odvajanje DNA lanaca) događa se tijekom ekspresije gena. Nitko ne govori da su čitavi kromosomi ili mikrobi sekvencirani u navodnom genomu SARS-CoV-2. Iako mogu, koliko znamo. Kažu da navodni markeri koji se koriste za testiranje ovog navodnog virusa nisu prikladni za tu svrhu.

Covid 19 – Dokaz svjetske prevare 5

RT-PCR testovi ne slijede čitav genom. Oni traže incidente specifične fluorescencije probe kako bi ukazali na prisutnost sekvenci za koje se tvrdi da postoje. Te su sekvence definirane s MN908947.1 i sljedećim ažuriranjima. Ovi početnici i probe nisu mogli otkriti ništa osim podudaranja RNA izvučenih iz nekodiranja, ponekad zvanog “smeće”, DNA (cDNA.)

Na primjer, gen SARS-CoV-2 S treba biti visoko specifičan za genom virusa SARS-CoV-2. Ciljni slijed je – TTGGCAAAATTCAAGACTCACTTTC. Mikrobiološko pretraživanje BLAST vraća 97 podudaranja mikroba sa 100% podudaranjem sekvence identiteta. Najniži postotak podudaranja identiteta, među prvih 100, iznosi 95%. Ljudski genom BLAST također pronalazi 100% podudaranje sekvence s 86 fragmenata humanog kromosoma.

Bez obzira gdje pogledali u navodnom genomu SARS-CoV-2, u testnim protokolima SZO nema ničega što jasno identificira o čemu se radi. Cijeli genom mogao bi biti lažan. Ispitivanja ne dokazuju postojanje SARS-CoV-2. Sve što otkrivaju je juha od nespecificiranog genetskog materijala.

Ako je tako, budući da nema izolata ili pročišćenih uzoraka virusa, bez održivog testa, nema dokaza da postoji SARS-CoV-2. Stoga niti ne postoje dokazi da postoji bolest nazvana COVID 19.

To dovodi do zaključka da ne postoji znanstvena osnova za bilo kakve tvrdnje o brojevima slučajeva COVID 19, hospitalizacijama ili smrtnosti. Sve mjere poduzete u borbi protiv ovog smrtonosnog virusa zasnivaju se na ničemu.

KONAČNA PRIJEVARA

Prijevara je kazneno djelo. Zakonska definicija prijevare je:

“Neki obmanjujući postupci ili plan s namjerom da se drugom oduzme pravo ili mu se na neki način nanese ozljeda.”

Pravna definicija zavjere je:

“Kombinacija ili savez između dvije ili više osoba nastao radi zajedničkog napora počinjenja nekog nezakonitog ili kaznenog djela”

Čini se da oni koji tvrde da se suočavamo s pandemijom nisu pružili nikakve dokaze da virus nazvan SARS-CoV-2 uzrokuje bolest zvanu COVID 19. Sve informacije koje snažno sugeriraju ovu mogućnost lako su dostupne u javnoj domeni. Svatko ih može pročitati.

Da bi došlo do prijevare, prijevara mora biti namjerna. Namjera mora biti namjerno oduzimanje prava drugima ili ozljeđivanje na neki drugi način. Ako postoje dokazi o dosluhu između pojedinaca i / ili organizacija radi počinjenja prijevare, onda je to zavjera (u jurisdikcijama Common Lawa) ili Udruženi zločinački pothvat (UZP) prema međunarodnom pravu.

Čini se da je COVID 19 namjerno korišten kao casus belli za ratovanje s čovječanstvom. Zatvoreni smo u vlastite domove, ograničena nam je sloboda kretanja, narušena sloboda govora i izražavanja, ukinuto pravo na prosvjed, odvojeni od voljenih, poslovanje uništeno, psihološki bombardirano, maskirano i terorizirano.

Još gore, iako nema dokaza o neviđenoj smrtnosti od svih uzroka, bilo je nerazumnih skokova u smrtnosti. Oni koreliraju s mjerama zaključavanja koje su rezultirale povlačenjem zdravstvenih usluga koje plaćamo i preusmjeravanjem javnih zdravstvenih službi na liječenje jedne navodne bolesti, isključujući sve druge.

Nadalje, oni koji su proslijedili priču o COVID 19 predlažu da ova navodna bolest daje opravdanje za cjelovito restrukturiranje globalne ekonomije, naših političkih sustava, društava, kultura i samog čovječanstva.

Da bi im se omogućilo sudjelovanje u njihovoj takozvanoj “novoj normalnosti“, koja je veleprodajna transformacija cijelog našeg društva bez našeg pristanka, inzistiraju da se podvrgnemo njihovim uvjetima.

To uključuje, ali nije ograničeno na, biometrijski nadzor svih, centraliziranu kontrolu i nadzor svih naših transakcija, opresivna poslovna i socijalna ograničenja te efektivne zahtjeve da nemamo pravo na suverenitet nad vlastitim tijelima. Ovo predstavlja uvjet ropstva.

Nema sumnje da smo lišeni prava i da nam je nanešena povreda. U jurisdikcijama Common Lawa pretpostavlja se nevinost, ali dokaza da je međunarodna zavjera namjerno prouzročila štetu ima napretek. Destruktivne politike, koje su donijele vlade širom svijeta, očito su nastale među globalističkim think tank-ovima i nadnacionalnim institucijama mnogo prije pojave ove nepostojeće pandemije.

U jurisdikcijama Napoleonovog zakonika pretpostavlja se krivnja. Da bi optuženi zavjerenici dokazali svoju nevinost moraju pokazati da, unatoč svojim neizmjernim resursima, kolektivno nisu mogli pristupiti niti razumjeti bilo koji od slobodno dostupnih dokaza koji sugeriraju da je COVID 19 mit.

Treba suditi odgovornima za kazneno djelo zavjere radi počinjenja globalne prijevare. Ako budu proglašeni krivima, trebali bi biti zatvoreni, dok mi ostali nastavljamo s pokušajima popravljanja štete koju su već nanijeli.

Izvor: off-guardian.org

Sviđa vam se portal Logično?
LAJKAJTE NAŠU STRANICU

(samo jednom, ako kliknete drugi put, Facebook će smatrati da nas ne volite)
Pretplati se
Obavijest
guest
212 Comments
najstariji
najnoviji najviše ocjenjeniji
Inline Feedbacks
View all comments
buga
Gost
buga
2 mjeseci prije

Evidentno je da se radi o prevari epskih razmjera. I evidentno je da većina zagljupljene mase vjeruje mantrama kojima nas svakodnevno zasipaju mainstream mediji i medicinari.Kabala je odlučila da je došlo vrijeme za eutanaziju beskorisnih izjelica na planetu i bojim se da im nitko nće pomrsiti planove.

Segota
Gost
Segota
2 mjeseci prije
Reply to  buga

Kalaš na rame i u šumu!!

Melz
Gost
Melz
2 mjeseci prije
Reply to  buga

.

zag
Gost
zag
2 mjeseci prije
Reply to  buga

Točno tako. niko se nikad nije zarazio od korone i umro od nje . Sveje to zavjera žute kabale i cionista.

tedi
Gost
tedi
2 mjeseci prije
Reply to  zag

A I PAPA IMA UMIJESANE PRSTE NA BERZI.

Ivan
Gost
Ivan
2 mjeseci prije
Reply to  buga

Nemaš kamo pobjeći. Budale su posvuda na vlasti.

MIR
Gost
MIR
2 mjeseci prije
Reply to  Ivan

Kad glistu presječeš

tihobl
Gost
tihobl
2 mjeseci prije
Reply to  buga

Izvor: off-guardian.org

Ocekivano da bacaju prasinu u oci. nece englezi reci da je ovo bakterioloski rat.

Mikojan
Gost
Mikojan
2 mjeseci prije
Reply to  buga

A ti ćeš prvi utrčati u njihovu mrežu a kad te ulove, šus u guz i mirna bosna !

Mirko
Gost
Mirko
2 mjeseci prije
Reply to  buga

200 zauzetih respiratora od 1000, popunjenost bolnica manja nego lani, gripa čudnovato nestala, smrtnost manja nego proteklih godina, prosjek preminulih 80 g…. Nema što, pandemija epskih razmjera

Coca Corona
Gost
Coca Corona
2 mjeseci prije
Reply to  Mirko

Stigla babi potvrda naredbe…

tedi
Gost
tedi
2 mjeseci prije
Reply to  Mirko

Pa da nisu glupi ne bi Njemci popusili dva svijetska rata.

A mi kako mi se cini opet cemo morati u patizane,jbt,kako se povijest ponavlja,samo sa razlicitim imenom ,za istu stvar,geostrateska blaga pojedinih zemalja. Ma sve isto C.P.

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Mirko

Strasna pandemija vlada, a umirovljeni profa fizike okolo postavlja centralna grijanja. Nesto je u disonanci u cijeloj prici.

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Mirko

Zamisli svi zatvoreni, a samo hrabri Đuka se zrtvuje i postavlja centralna i toplinske pumpe. Puno propusta ta Anđa sto ne navrati na Logično. Nema sanse da ne uoči takvog “kapitalca”.

Sterilizacija za pun
Gost
Sterilizacija za pun
2 mjeseci prije
Reply to  Mirko

Kazen za zločin na Judi, Sirci in vsemi vmes.

... ....
Gost
... ....
2 mjeseci prije
Reply to  buga

Jer kako može bit laž nesto šta stalno i svuda ponavljaju? Npr. radio na vijestima kaže današnje brojke, a onda voditeljica jutarnjeg programa niti 5 min. kasnije kaže ovako nekako: “Ako niste čuli, danas je blabla novih.., ..mrtvih.., ..uključujemo u program županijskog epidemiologa.., blabla..”

Taugo
Gost
Taugo
2 mjeseci prije
Reply to  buga

Daj Đuro ne pizdi više , nije ovo više zajebancija!!

Kontradmiral
Gost
Kontradmiral
2 mjeseci prije
Reply to  buga

A da ti je roditeljka isla nea vece umjesto u rrodilista nama bi bilo ovde puno ljepse

Vprašam vas
Gost
Vprašam vas
2 mjeseci prije
Reply to  buga

ali ventilator zdravi ali pobija?

Sparkling
Gost
Sparkling
2 mjeseci prije

I sad Vi poštovani komentatori objasnite koja je to koincidencija da Kina nije imala “drugi val” a možda je i prvi val bila prevara?????
Tko je Trumpu dao savjet da prekine financiranje WHO? I zašto je odmah upro prstom na povezanost Kine i WHO-a????
Pa zar Wuhan i sve one sestrinske tvrtke povezane s tom pričom u dotičnom laboratoriju nijsu dovoljne da se napokon poslože sve kockice?
Neznam, nisam pametan. Netko se opasno igra, ili je ovo samo predigra za otkrivenje koje nam slijedi.

Sparkling
Gost
Sparkling
2 mjeseci prije
Reply to  Sparkling

Đuro, moje je mišljenje da si ti vrlo zabavna i smiješna osoba. Svako dobro ti želim.

mirko
Gost
mirko
2 mjeseci prije
Reply to  Sparkling

Ajde se negdje drugo mentalno relaksiraj da se malo i mi relaksiramo.

Zoran
Gost
Zoran
2 mjeseci prije
Reply to  mirko

Postovani Djuro dobar sam jos pa svake godine dovedem drugu Nizozemku na godisnji, nijedna ne moze povjerovati da su sve te pa i moja kuce bez hipoteke zivio sisyem vjecitih dugova dajte nam natrag nekog pa makar bio i copav

Nazdravje
Gost
Nazdravje
2 mjeseci prije
Reply to  Zoran

Zamoli čedomira debelog da ti iznajmi punicu ona dobro stoji na bananu ka i šajkača!

Coca Corona
Gost
Coca Corona
2 mjeseci prije
Reply to  Sparkling

Ridikul

Raulko
Gost
Raulko
2 mjeseci prije
Reply to  Sparkling

Kaj si naslijedil partizansku “penziju”..nisam znal da su tifusari kod vas u zagorju u penziji..kod nas u Hrvatskoj su ljudi u mirovini..!!

tedi
Gost
tedi
2 mjeseci prije
Reply to  Raulko

a sta fali,kako god se zvala,lova je lova,ona ne prepoznaje jezik ni granice..

Na traktore
Gost
Na traktore
2 mjeseci prije
Reply to  tedi

Braniš ga, siguroga je ukeka čedo čvorović!?

pera lozac
Gost
pera lozac
2 mjeseci prije
Reply to  Raulko

Da a od nedavno nasedaju na “prijevare” i voze se u “prijevozu”.
Ti si duplo gori od Debelog koji je procitan odavno ali drzi se svoje price ko pijan (mozda i jeste) plota, profesor, fizicar, matematicar i neustrasivi branitelj, a eto niki dan saznadosmo i da je vodoinstalater a od veceras i poduzetnik koji je zaposlio tri hajvana, nebih se zacudio da uskoro “ispliva” i neki doktorat.
Debeli je na ovom portalu da bi nas ubedio kako je korona opasna (skoro pa kuga) da su vakcine bogom dane i da se svi trebamo vakcinisat, da su alemka, capak herr vili ostala gamad apsolutno u pravu i slicno tome.
A ZASTO si se ti pojavio?
Smeta ti so nema psovanja hrvatskih, srpskih i muslimanskih majki, pa eto ti da nas napomenes sta smo zaboravili?
Vrati se u rupu iz koje si izgmizao pa tamo objasnjavaj razliku izmedju penzije i mirovine.

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  pera lozac

Lijep odgovor, kolega.
Nacionalizam si može gurnut tamo gdje sunce ne sija.

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  Raulko

Mi u Zagrebu umirovljenike zovemo penzići, OK? Da. Iste izbosne? 😛😄

Hih🤪
Gost
Hih🤪
2 mjeseci prije
Reply to  Sparkling

To Đuro objasni tupanima

MIJA
Gost
MIJA
2 mjeseci prije
Reply to  Sparkling

DEBELI LIČI NA ĆALETA SESELJA, NE OKUPAN, NE OŠIŠAN, NE OBRIJAN,PIJAN,I UDARA NA ŠLJIVOVIC!

Faust
Gost
Faust
2 mjeseci prije
Reply to  Sparkling

Radiš ti k…. Čitav dan si za tipkovnicom i zagađuješ virtualni prostor.

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Sparkling

I nazalost umirovljeni dio obrazovnog sistema. Samo se nazalost pokazuje da jednom zadojen mentalni sklop tesko se oporavlja. Nista osobno samo kao pokazatelj trajne indoktrinacije.

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Sparkling

Nije predigra nego kruna ili korona onog na cemu intenzivno rade i pripremaju zadnjih 20 godina. Ako padne kruna pada i projekt i projektanti. I onda ce definitivno bit Nwo, ali ne robovlasnicki kakav su “majstori” smislili.

Vprašam vas
Gost
Vprašam vas
2 mjeseci prije
Reply to  Sparkling

Vojna s Kitajsko?

Sena
Gost
Sena
2 mjeseci prije

Nadam se da kovid-19 nije generalna proba za mogući kovid-21.

mario
Gost
mario
2 mjeseci prije
Reply to  Sena

Je proba

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  mario

Covid 21 moguć samo primitkom mRNK tzv. cjepiva odnosno tehnologije. Do tad imunitet vlada. Ili kako to biskupi vole reci ovo je cisti grijeh, ali kada ne postoji nista drugo (pazi molim te) onda je dozvoljeno sudjelovati u grijehu. Hahaha isto kao i minus u banci, ali ako je dozvoljeni minus onda je to druga priča.

tedi
Gost
tedi
2 mjeseci prije
Reply to  Sena

samo se ti nadaj ide ona do kovid 30.Ali neka ide nadam se da ce bar za godinu pokrepat ono crno plemstvo,a njihovi mladi izgledaju kao od papira. Geni su cudna stvar ako se ne drze pod kontrolom cesto zakucaju u ludake.

Mujo
Gost
Mujo
2 mjeseci prije
Reply to  Sena

“Debeli” čvoroviću iš, ćuš,kuš, trči kući, čuvat punicu i ženu!

Bella Luiga
Gost
Bella Luiga
1 mjesec prije
Reply to  Sena

Točno.

Mölltaler
Gost
Mölltaler
2 mjeseci prije

Možete vi iznositi dokaze koliko hoćete, ali njihova agenda ide dalje.
Sa njom nažalost idu i maltretiranja, kažnjavanja, ponižavanja, trovanja maskama, nedostupnost medicinske pomoći……
Minimum 95% ljudi (mada nisam siguran dali zaslužuju da ih se tako zove) djelomično ili u potpunosti vjeruje u cijelu priču i taj postotak se ne smanjuje bez obzira na to što neki tvrde suprotno.

tedi
Gost
tedi
2 mjeseci prije
Reply to  Mölltaler

1100% si u pravu,evo ja se razgulih pricajuci u svojoj kuci,moja punica vec ima rane po rukama,krv joj probija,a ona ne odustaje koliko pere alkoholom i asepsolom i ogradu na terasi,kada sam joj rekao uzmi rukavice,ona me gleda ko tele,a kak cu prati sve po kuci u jednim rukavicama,poludio sam i popio rakiju da mi ne pozli.
Izgleda svi mamo svoje horoskope cim se rodimo.

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  Mölltaler

Ma nema valjda 95 %? 😄😂

pera lozac
Gost
pera lozac
2 mjeseci prije

U ima ima, sinoc tj juce oko 17 sedoh na terasu kafica (u skoro celoj Italiji su otvoreni do18) kad stizu tri para od 45 do 60 godina, brnjica za stolom naravno nije obavezna ali oni neposustaju, aj reko cekaju pice pa ce poskidat.
Jes bas, spusti se maska, srkne gutljaj i maska se vraca preko nosa a ista procedura upotrebljava sa grickalicama.
Vecina je toliko zaglupljena da je to neverovatno, ima ih koji okrecu glavu nastranu ili cak stanu i okrenu se prema zidu kada me sretnu, zato sto zato sto brnjicu nenosim ili ju nosim na bradi iako je obavezna i na ulici ali zato su mi oci postale kao u kameleona, da me murija nebi zaskocila i otela 400 eurica.

piždro
Gost
piždro
2 mjeseci prije

Iluminati se igraju s’nama ko sa stokom sitnog zuba, i mi ništa ne poduzimamo.. nego izvodimo raznorazne interpretacije
njihova viđenja situacija… jadno i žalosno

piždro
Gost
piždro
2 mjeseci prije
Reply to  piždro

“Najvažnije vijesti od 13. prosinca 2020

14. prosinca 2020

Zaključavanje 2.0 (Lockdown 2.0: The prolongued genocide) : Produženi genocid
* toplo preporučljivo u cijelosti. (d) Kralj sluga: Uvod
d)König der Knechte: Einführung (Servant King: Introduction)

Kralj sluga je prvorodno/rodno pravo [neotuđiva prava] svih ljudskih bića od trenutka kad udahnu do njihove prirodne smrti. Pojam prvorodstva danas se rijetko koristi u našem rječniku.
[…]
Naše pravo prvorodstva/rodno pravo je ono što sadrži naše nasljedstvo, a ono pak sadrži svu našu moć, imovinu, prava i dužnosti; i to je naše jedino i najdragocjenije vlasništvo. Nažalost…”
ps puno više o tom na:
https://dudeweblog.wordpress.com/2020/12/13/20129/

Stock
Member
Stock
2 mjeseci prije
Reply to  piždro

Da je Zagreb velegrad?

Sony
Gost
Sony
2 mjeseci prije
Reply to  Stock

😅

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  piždro

S nostalgijom se sjećam kak su građani dočekali Vatrene, pa i Papu, vrijede li oni više od naših života, jebem ti narod tupavi, kruha i igara dajte dudekima .. 😒😞

piždro
Gost
piždro
2 mjeseci prije
Reply to  piždro

o gdje si ti meni Đurek, hebeš coronu i NWO. stara dobra vremema ljudskog druženja su nam pokradena i tu su nas zahebali majstori mraka .. bjelosvjetski kapi-feudalizam je sve okrenuo napačke!! a ponajviše udaljio čovjeka od covjeka i na zalost uspjeli su u tom! jer je 98 % ljudi čista naiva i vjeruje sve silama mraka

Mujo
Gost
Mujo
2 mjeseci prije
Reply to  piždro

Mali “čiko” bre begaj kući, čekate žena i punica,a ti se vrtiš po internetu,kao magarac oko tuđih vrata, a one po selu “banane” traže!

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  piždro

To predstavlja veliku zaradu na maskama, dezificijensima i buduci profit na onima koji prime “civilizacijsku” tekovinu koja se cuva na -80 celzija ovaj puta bez konzervansa. Zanimljivo zar ne?

Suzy
Gost
Suzy
2 mjeseci prije

Sve je evidentno ali i dalje svi sutimo i oni guraju svoje

piždro
Gost
piždro
2 mjeseci prije
Reply to  Suzy

Suzy nisi primjetila..? iza ovog je top članak o velikom vođi, inače tvoj omiljeni lik.. hehe

piždro
Gost
piždro
2 mjeseci prije
Reply to  piždro

pardon Suzy – tek sam kasnije vidio da nisi izostavila velikog vođu

rimtu
Gost
rimtu
2 mjeseci prije

Dobar članak.
Nadam se da će se pobornici “zlog virusa” malo smiriti sada.

Ivan
Gost
Ivan
2 mjeseci prije

Ovo neće završiti bez krvoprolića.

kim
Gost
kim
2 mjeseci prije
Reply to  Ivan

Ma ne luduj,naguzit će debeloga,i sve će boljke proći!

Tupko Glupko
Gost
Tupko Glupko
2 mjeseci prije

Zanimljivo da Kina de facto službeno skoro da i nema niti jednog mrtvog od Covid-19 još od travnja 2020.: China Coronavirus: 86,741 Cases and 4,634 Deaths – Worldometer (worldometers.info) Gospodari Kaosa očigledno su odlučili ekonomski izdići Kinu, a ostatak svijeta gospodarski uništiti svojim Covid-19 mjerama i uvesti politički ono što je u Kini potpuno uobičajeno – npr. jedna Partija koja vlada, snimanje kamera koji automatski mjere temperaturu ljudi i prepoznavaju podatke o njima temeljem snimanja njihovih lica: China to Roll Out Infrared Fever Screening Cameras on Public Transport (cbronline.com) Do 2019. već su imali u sustavu 200 milijuna CCTV kamera (na 1,4 milijardu stanovnika, dakle jedna kamera na sedam stanovnika). Imaju i sustav bodovanja svojih podanika (social credit system): China social credit system, punishments and rewards explained – Business Insider Zanimljivo, baš ove godine je počela njegova implementacija. Dakle, iz ovog teksta je vidljivo da vas država ocjenjuje kao svog podanika/roba, te vam temeljem toga može uskratiti letove, korištenje vlakova, smanjiti vam brzinu interneta, onemogućiti studiranje, raditi tajne crne liste nepodobnih, spriječiti dobijanje lukrativnih poslova, odlazak u hotele, ako ne vodite psa na povodcu itd. I to je upravo “novo normalno” o kojem nam stalno pričaju politički visoko pozicionirani likovi… Pročitaj više »

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  Tupko Glupko

Bit će “normalno”, tek kad nam svima uvedu kineski model, a onda zajedno u svijetlu budućnost.

tihobl
Gost
tihobl
2 mjeseci prije
Reply to  Tupko Glupko

dakle jedna kamera na sedam stanovnika…

A koliko je u Londonu?
I kako prolaze oni koji se suprostave vladajucim dogmama u Engleskoj?

Kinezi ni za 10 godina nece dostici engleze.

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  tihobl

Ma već su ih prestigli.. ✌️

pera lozac
Gost
pera lozac
2 mjeseci prije
Reply to  tihobl

Zadnji podatci koje sam nasao za VB su iz 2013 i kaze 6 milona znaci jedna na svakih 10 stanovnika a 2011-e je bilo 1 na 11, ako su nastavili istim tempom, u sta nesumnjam, danas bi trebalo da su na 1 kamera na svakih 6,5 stanovnika.

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  Tupko Glupko

Eh, tupko, da smo barem svi glupi kao vi.., prva ja.. 😞 E, neće biti kineskog modela, barem u zapadnoj kulturi, vidim kako su se uobrazili I uzoholili, pesojedi pokvareni 😈😬 noooo waaaay, promise… ❤️ ✌️✌️✌️✌️😇

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Tupko Glupko

Kina je predviđena kao centar robotizacije u nwo.

Legendarni Grk
Gost
Legendarni Grk
2 mjeseci prije

Zapravo se ovdje radi o trovanju preko cjepiva, zraka (chemtrails), hrane i vode, a otkriveni otrovi (u chemtrails) su aluminij, barij, stroncij, osiromašeni uran, itd. U zadnje vrijeme su pojačali koncentracije tih otrova koje bacaju na ljude avionima, a poznato je da trovanje ide i preko hrane, vode i lijekova. Kod nas u Hrvatskoj je direktno trovanje preko zraka počelo kada smo ušli u NATO, dakle negdje 2009. godine ili čak i ranije.   Ovdje dva doktora s puno detalja objašnjavaju što se zapravo događa i raskrinkavaju prevaru s nepostojećim virusom:   https://zajednohrvatska.wordpress.com/2020/12/08/5-milijuna-dolara-nagrada-za-dokaz-covid_19-virusa-i-nitko-se-ne-javlja/ Neke vrste mikrovalova mogu (namjerno, preko postavljenih antena) izazvati zgrušavanje krvi – koagulaciju, pa jedan doktor odlično objašnjava kako je problem u krvi, a ne u nedostatku kisika u plućima, ali ovi to uporno sakrivaju iz fiktivnog „korona“ virusa – zato terapije respiratorom ne pomažu i ljudi umiru. Naime, mikrovalovima se može onemogućiti prijenos kisika u stanicama, a u kombinaciji s trovanjem to daje poznate simptope kod oboljelih. Autopsije koje Banda zabranjuje su pokazale da je tromboza uzrok smrti svih tih plućnih i ostalih „korona“ bolesnika – ovo je potvrđeno u 5. mjesecu u Italiji i nedavno u Njemačkoj, pa i u Srbiji. I ta tromboza je… Pročitaj više »

Legendarni Grk
Gost
Legendarni Grk
2 mjeseci prije
Reply to  Legendarni Grk

Stari tekst koji potvrđuje gornji tekst – 5. mjesec 2020. – kako su talijanski liječnici nakon od WHO “zabranjenih” obdukcija otkrili što se zapravo događa u tijelima umrlih od “korona” virusa: Lijek za koronavirus napokon je pronađen u Italiji samo zato što talijanski liječnici nisu poštivali globalni zakon WHO o zdravstvu, koji ih poziva da ne obavljaju obdukciju umrlih od koronavirusa pa su otkrili da to NIJE VIRUS, već BAKTERIJA koja uzrokuje smrt stvarajući ugruške u krvi i smrti pacijenta. Tako Italija pobjeđuje tzv. Covid-19, koji nije ništa drugo do “uobičajena intravaskularna koagulacija” (tromboza).   “A način na koji se nositi s tim, to jest njegovim liječenjem, jesu “antibiotici, protuupalni lijekovi i antikoagulansi.” Prije svega – ASPIRIN.   Ovu za cijeli svijet senzacionalnu vijest utvrdili su talijanski liječnici obdukcijom umrlih navodno od Covid-19. “A ipak, prema talijanskim liječnicima anatomski respiratori i jedinice intenzivne njege, nikada nisu bili potrebni već su samo pospješavali smrt.”   Sada je u Italiji započela promjena protokola, pa je i WHO prisiljen popuštati i uklanjati globalnu pandemiju koju su sami stvorili i nametnuli putem potplaćenih medija i korumpiranih političara.   Covid-19 … nije virus, kako su nas na silu i pod prijetnjom kaznama i kaznenog progona… Pročitaj više »

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  Legendarni Grk

Sreća da imam snižene trombocite.. 😞 Navodno su našli i cijanid u chemtrailsima, to sam negdje izguglala.. 😕

Bobo
Gost
Bobo
2 mjeseci prije

Svi znamo da je ovo prevara ali nitko ništa ne čini po tom pitanju!

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  Bobo

Budite prvi, molim 😄✌️

Rocco Paic
Gost
Rocco Paic
2 mjeseci prije

Pozivam redakciju portala Logicno da mom prijatelju koji ima 34 godine, a koji je bio potpuno zdrav do prije 15 dana objasni da je bolest kolokvijalno zvana korona prevara. Naime, taj moj prijatelj leži u bolnici, već dva dana je na respiratoru i upitno je hoće li preživjeti. Ako ga želite posjetiti i to mu objasniti (možete i njegovoj majci) rado ću Vam dati potrebne podatke.

Penzija
Gost
Penzija
2 mjeseci prije
Reply to  Rocco Paic

Jel nije respirator rasparac pluca?

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  Rocco Paic

Bolestan je jer je “zatrovan” i “čisti se”.
Kaj, na imbexu nema tema za trolanje?

Ožujsko light
Gost
Ožujsko light
2 mjeseci prije
Reply to  rimtu

Šta je to sa tim trolanjem na tom imbexu što jedni ovdje uvijek napominju? Koliko čitam i tamo je večina komentatora proti usranog covid cjepiva.

Penzija
Gost
Penzija
2 mjeseci prije
Reply to  Ožujsko light

Mozda si sretnik pa potrefis kad trolovi dobiju sendvice.

tedi
Gost
tedi
2 mjeseci prije
Reply to  Penzija

Podijelio sam na FB beogradski sindikat -pijesmu sistem te laze- i zbrisali mi,nesmijem stavit link ali ima na YT,cijeli dan je pustam.

Jadranka Belančić
Gost
Jadranka Belančić
2 mjeseci prije
Reply to  tedi

Ja još uvijek radije slušam hard rock i blues.., makar sam penzicka.. Pokušati ću naći to , fala.. 😞

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  Ožujsko light

Je, ali ima i divizija “sendvičara”.
Ponekad i tu navrate.

Simon
Gost
Simon
2 mjeseci prije
Reply to  Ožujsko light

Koliko se meni čini na Indexu su profesionalni trolovi, a ovdje su uglavnom amateri za trolanje kojih nisam siguran kako bi im itko dao sendvič ili coca colu.

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Simon

Tu se odrađuje pripravnicki i sto vise inteligentnih ljudi isprovociras veci rejting, a poslije na parizer jer rejting ne puni zeludac naravno politicari su izuzetak.

mario
Gost
mario
2 mjeseci prije
Reply to  Ožujsko light

Većina bez trolova

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Ožujsko light

Nije cjepivo nego tehnologija u dvije riječi opisiva kao genetski zajeb.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  Rocco Paic

Ako nosi masku neprestano od marta, dobro je i prošo

The Who
Gost
The Who
2 mjeseci prije
Reply to  Rocco Paic

Kako ti nije palo na pamet da ti Beroš nešto objasni

Mikojan
Gost
Mikojan
2 mjeseci prije
Reply to  The Who

Pa objasniti će mu da je zaraza virusom i šta više da objašnjava? Njega ima da se sluša a kada je početkom 2019. bila prava epidemija virusne upale pluća u Hrvatskoj nitko nije pitao zašto, od kuda i koji virus je uzrokovao to. Najčešće objašnjenje je bilo da je gripa uzrokovala upalu pluća i mnogi su umrli pa nije bilo ni jednog jedinog slova na TV ili radio stanicama o epidemiji.
ZAŠTO ?

pera lozac
Gost
pera lozac
2 mjeseci prije
Reply to  Mikojan

Nije bilo vreme, zato sada i babe od 100 godina umiru od “korone” a to bedni novinari objavljuju toliko dramaticnim glasom kao da ju je korona zakinula za sledecih 100.

tihobl
Gost
tihobl
2 mjeseci prije
Reply to  Rocco Paic

Ovde imas likove koji idu u krajnost kao da rade u kriznom stabu, ali suprotnu krajnost.
U kriznim stabovima svaki dan smisljaju nove teorije i prepadaju narod, a ovde tvrde da virus ne postoji i da je sve izmisljotina.
Pocinjem da sumnjam da je rijec o istim ljudima – na poslu pustaju jedan spin, a poslije posla suprotan.

hiber
Gost
hiber
2 mjeseci prije
Reply to  tihobl

Da, u pravu si. Najveća vjerojatnost je da se radi o strahu. Jedni u strahu paniče, drugi zabiju glavu u pijesak. Najmanja vjerojatnost da se radi o nekakvoj zavjeri. Naravno ne treba isključiti ni jedno.

bezelbub
Gost
bezelbub
2 mjeseci prije
Reply to  Rocco Paic

Dzabe ti to ovim budalastim teoreticarima zavjere govoris previse su to zaludjene osobe

Dani
Gost
Dani
2 mjeseci prije
Reply to  Rocco Paic

A zašto ti ne pitaš kako to da tvog prijatelja nitko ni ne pokušava liječiti klorokinom, cinkom i antibiotikom nego svi čekate da umre na respiratoru? Kako to da je to zabranjena tema? Baš si pravi prijatelj… Navuci tu brnjicu malo bolje i pomoli se luciferu, možda to nekog spasi.

mario
Gost
mario
2 mjeseci prije
Reply to  Dani

Bravo dani

VRTENO
Gost
VRTENO
2 mjeseci prije
Reply to  Dani

za,tebe iIe, dvi banane dosta, pa imaš tapun za donju i gornju rupo,na gornjoj i donjoj glavi!?,ALI BEZ ŠLJIVOVIC

Mr.T
Gost
Mr.T
2 mjeseci prije
Reply to  Rocco Paic

Na indexu imas dosta ovcica kojima mozes lagati. Ili su te vec i tamo provalili 😊

Rocco Paic
Gost
Rocco Paic
2 mjeseci prije
Reply to  Rocco Paic

Još uvijek čekam da mi se javi redakcija portala Logicno. Dostavit ću im podatke koje sam obećao. Ravnozemljašima i ostalim likovima kojima je korona teorija zavjere (čipiranje, Bill Gates, masoni…) doista nema smisla odgovarati. Uostalom, nisam im se ni obratio.

Dani
Gost
Dani
2 mjeseci prije
Reply to  Rocco Paic

Papčino, izbjegavaš odgovor? A kome si se ti to onda obratio javnim komentarom ovdje? Daj se zavuci u rupu iz koje si i isplazio, tamo vlada jednoumlje i ne postavljaju se neugodna pitanja. I ne zaboravi brnjicu.

Rocco Paic
Gost
Rocco Paic
2 mjeseci prije
Reply to  Dani

Papčina te okotila. Kako ti se to sviđa? Da znaš čitati s razumijevanjem shvatio bi da sam se javno obratio portalu Logicno.

Penzija
Gost
Penzija
2 mjeseci prije
Reply to  Rocco Paic

Tuzi redakciju vrhovnom sudu

Pera Detlic
Gost
Pera Detlic
2 mjeseci prije
Reply to  Rocco Paic

Nijesu li vaseg frenda prvo testirali, pa onda pozitivnog prč na korona tretman? Uzmite nalaze i posaljite nekom doktoru o kojem je i Logicno pisalo ili dopustite da vam frenda lječe doktori koji nazivaju budalama i glupanima tko ne primi korona tehnoloski koktel.

shumadinac
Gost
shumadinac
2 mjeseci prije

Niste me slušali, a? Jel ja sve vreme pričam da nije SARS-CoV-2 nego SARS-CoV-3 a vi mi ne verujete? Kako da ga pronađu kad traže pogrešne registarske tablice??? A i ovi što su se razboleli i umrli – sve na psihološkoj bazi. Zar nije jedan od simptoma gubitak mirisa i ukusa? To su ih ubedili kako ne bi mogli da kažu da im tu nešto smrdi 🙂 —————— Pažljivo pročitajte izjavu: “Ako testovi za ovaj novi virus ne identificiraju ništa što bi moglo izazvati bolest kod ljudi, cijela pripovijest o COVIDU 19 nije ništa drugo do šarada” Ovo bi značilo otprilike: “Ono što nije bilo na TV-u (danas na netu) to ne postoji”. Osnovni problem sumanutih teoretičara zavere je što jednom informacijom “dokazuju” sve ostalo! U redu, PCR testovi ne valjaju, virus nije dokazan – možda i ne postoji, samim tim je i vakcina nepouzdana (da ne govorimo o svemu ostalom vezanom za nju) ali kako za Boga miloga to može da znači da “cijela pripovijest o COVIDU 19 nije ništa drugo do šarada“??? Jer ljudi obolevaju, imaju vrlo specifične simptome koji nisu karakteristični za druge, slične bolesti. I umiru! Apsolutno podržavam da se sve istera na čistinu, da se… Pročitaj više »

Tupko Glupko
Gost
Tupko Glupko
2 mjeseci prije
Reply to  shumadinac

U Hrvatskoj u prosjeku umire 140-150 ljudi na dnevnoj bazi, što je i normalno da na populaciju od 4 milijuna stanovnika godišnje umre više od 50.000 osoba (otprilike 1,3% populacije). Dakle, u prosjeku u Hrvatskoj mjesečno umre oko 4.500 ljudi. Ovdje je službena statistika za čitav svijet u postocima od čega ljudi najviše umiru (podaci za 2016. godinu): Leading cause of death world – List of causes of death by rate – Wikipedia Kao što vidiš, kardivovaskularne bolesti su na prvom mjestu sa 17,65%, a srčane bolesti na drugom sa 8,93%. Uoči da ljudi koji umiru od respiratornih problema čini 6% umrlih. To bi na mjesečnoj bazi u Hrvatskoj činilo 300-ak ljudi. Glavno je pitanje koliko je ljudi umrlo SA koronom, a koliko OD Covid-19. Kao što vidimo, prosjek starosti službeno umrlih od/sa Covid-19 je otprilike kao i prosječan životni vijek ljudi u Hrvatskoj. Prošli mjesec (studeni 2020.) bio udarni što se tiče mrtvih koji su umrli od/sa Covid-19, brojka je negdje oko 1.500, što znači da je svaki treći umrli u Hrvatskoj službeno umro od/sa Covid-19. Ono što će biti najbolji pokazatelj je li ovo prijevara ili nije, jest kada će se početi dobijati službeni podaci za studeni/prosinac/siječanj o… Pročitaj više »

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  Tupko Glupko

Nije mi namera lična kritika ali sam primetio da se ljudi lako pozivaju na statistike kada im odgovaraju i obratno.
Mogu ja do prekosutra da pokazujem statistike mojim kumovima ili komšiji koji su prelezali koronu, ili porodici poznanika koji je od nje umro.

Lekar, moj prijatelj, koji je lečio tog poznanika (a svi smo išli u istu školu) kaže: “Jeste bio težak šećeraš, jedva smo ga spasili pre neku godinu od srčanog udara ali je mogao da živi još desetak godina”.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  shumadinac

Taj Lekar je prorok!!!!
Meni iz kruga u kome se krećem i znam stanje u obiteljima,
ništa posebno,osim velke doze straha!
Znam roditelje čije je dite umrlo u karanteni,u Baliju /3_2020,u karanteni od tropskih boleština sa 14mjeseci!!!!
Bili ostalo živo,da nije prisilno stavljeno u karantenu na tjedan dana,ne znam ,pretposravljam da da…hoćeš još horora iz prve ruke??? Talasaš ko dnevnik sa stavom…zašto?!
P.S.I djete i roditelji su bez simptoma strpani na odjel…da bi sva 3 testa bili – .
prekasno

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  KISIK

Da li sam ja ikada rekao da vlast ne pravi greške, da su napravili dobru organizaciju, da postupaju na pravi način?

Ja kažem da postoji i druga strana ovog problema ogromna većina priznaje samo jednu ili drugu stranu.

Coca Corona
Gost
Coca Corona
2 mjeseci prije
Reply to  shumadinac

Namjerna greška nije greška! Već neodgovorno ponašanje iza maske.

Ako si greškom nekoga upucao!? Makni se od “puške” ds se ne ponovi.

mario
Gost
mario
2 mjeseci prije
Reply to  shumadinac

Je li to jedan doktor od onih plaćenih, ili programiranih ili školovanih od farmaceuta ili jedan od onih što uz sve škole još neshvaća da je pandemija lažna ili je to jedan od onih što hoće još jače zaključavanje, koji je od tih?

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  mario

Ma plaćenik – zar nisam rekao da smo školski drugovi?

mario
Gost
mario
2 mjeseci prije
Reply to  shumadinac

Ok

CAN
Gost
CAN
2 mjeseci prije
Reply to  shumadinac

Oba plače nici?

Dani
Gost
Dani
2 mjeseci prije
Reply to  shumadinac

Izgleda da neka bolest ipak postoji (kakva, od kuda, ne znam, sve upućuje na gmo virus) kao i da postoji više lako dostupnih lijekova za nju (klorokin…). Ljudi umiru jer im je uskraćen tretman tim lijekovima i umjesto toga se stavljaju na respiratore od samog početka.

Simon
Gost
Simon
2 mjeseci prije
Reply to  Dani

Neznamo da li se radi o bolesti ili posljedicama djelovanja biološkog oružja.
Pa nitko nezna odakle je taj navodni virus. I oni koji se bsve imunologijom i vurusologijom ne slažu se.
Što god da je, to je poslužilo za najveću prevaru u ovom stoljeću.

Dani
Gost
Dani
2 mjeseci prije
Reply to  Simon

👍

Mikojan
Gost
Mikojan
2 mjeseci prije
Reply to  Dani

Ako je GMO virus, tko ga je stvorio, tko ga je distribuirao među ljude? Zašto se ne pokrene istraga o tome umjesto da se zatvaraju ljudi. Ja jesam za neke mjere protiv širenja ali ako te mjere ne postiguni rezultate za 30 dana onda su bezvrjedne, nema koristi. Ljudi su toliko isprepadani da na svako curenje nosa trče na testiranje, zaboravili su da im je nos do danas curio barem 2-3 puta godišnje pa se nisu na ništa testirali i evo doživjeli su do doba COVID-19, užas jedan.

Dani
Gost
Dani
2 mjeseci prije
Reply to  Mikojan

Stvorile ga “elite” i pustile među ljude, WEF, WHO, Gates, Rockefelleri itd… Nije baš jako opasan, da li namjerno ili kao što dr.Sladoljev kaže da ni ne može biti pre opasan jer virusi brzo mutiraju i prilagođavaju se domaćinima, a i imuno sistem je strašno močna stvar u zdravih pojedinaca. “Elitama” je i onako bitna panika da ostvare svoje ciljeve. Činjenica je da znanost još uvijek baš nije na čisto sa tim što su zapravo ti virusi, htjeli oni to priznati ili ne. Ako je uopće virus u pitanju…

Simon
Gost
Simon
2 mjeseci prije
Reply to  shumadinac

Pročitam ponekad po nekoliko tvojih komentara i često uopće ne razumijem što želiš reći.

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  Simon

Nisi jedini, misliš da je slučajno?

mario
Gost
mario
2 mjeseci prije
Reply to  rimtu

Duša mu je izabrala stranu

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  rimtu

@Simon & rimtu
Pre neku godinu su se na ovom portalu vodile ozbiljne diskusije, moglo se mnogo toga naučiti… A onda je krenulo besomučno pljuvanje neistomišljenika i to po pravilu od onih koji u običnom životu ne smeju ni da pisnu.
Nezdrava atmosfera je oterala puno dobrih kolega tako da sam sada u situaciji da objašnjavam očigledno. Sinoć je bilo odličnih primera – recimo sa Stock-om gde me pita da mu objasnom ono što je bukvalno već bilo napisano u predhodnom komentaru.

Ako vi ne razumete to ne znači da je nerazumljivo. U istom tekstu sinoć na repliku Piretisu Bauštelac stavlja upitnike (pita šta sam hteo da kažem) a ispod koleginica Slonica objašnjava i bolje nego što bih ja uradio. Dakle, na sreću još uvek ima i onih koji razumeju.

Simon
Gost
Simon
2 mjeseci prije
Reply to  shumadinac

Neznam zašto pišeš o drugima i tko koga pljuje. To mene ne interesira.
Moja primjedba se tiče komenrara koje pišeš i koji izazivaju zbrku što se vidi i po daljnjim konentarima koji se nadovezuju.
Evo, pišeš i pišeš pa napišeš ljudi umiru. Pa umiru i što onda, umirali su i umirati će, stvarno nerazumjem. Oprosti.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  Simon

Slažem se.

Stock
Member
Stock
2 mjeseci prije
Reply to  shumadinac

“Sinoć je bilo odličnih primera – recimo sa Stock-om gde me pita da mu objasnom ono što je bukvalno već bilo napisano u predhodnom komentaru.”
Šta da kažem na ovo?
Iskreno mi je žao što ne ispunjavam tvoje kriterije inteligencije i što tvoje nerazumljive textove pokušavam, pitanjima, shvatiti.
To što si ti umišljena zvjezda geopolitike ne bi trebao biti moj problem, pa sam što se tiče tebe, nakon kraćeg razmišljanja, odlučio staviti led na jaja.

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  Stock

Stavio sam ispod primer iz ovog teksta a nisi odgovorio – je li led u pitanju?

mirko
Gost
mirko
2 mjeseci prije
Reply to  rimtu

Ne lupaj.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  shumadinac

Od čega UMiRU???,
daj na obdukciju…
,fali im kisika,zašto?

mario
Gost
mario
2 mjeseci prije
Reply to  shumadinac

Ljudi oboljevaju kao i prošlih godina ni više ni manje, sezonske gripe. Zato i je to šarada, šta ti nije jasno

Simon
Gost
Simon
2 mjeseci prije
Reply to  mario

Ne samo gripa, znam kad bih imao temperaturu, gubitak okusa i mirisa, otežano disanje, bol u svim mišićima i kad bih otišao kod obiteljskog liječnika ne bih dobio dijagnozu gripe nego bi mi bilo rečeno ‘to su ove viroze sada oko nas’. Također znam kad bi bile ‘te viroze’ kako roditelji po tjedan, dva i više nebi vodili djecu u dječji vrtić.
Jedina razlika koju primjećujem je to što tad nebi bilo niti riječi u medijima o tome, a danas je virus tema 35 minuta u dnevniku, a sve ostale teme stanu u preostalih 5 minuta.
Ako treba mogu svima koji ponavljaju skriptirane vijesti s tv-a reći kako su ‘pukli’ i teško će me uvjeriti da nisu.

mario
Gost
mario
2 mjeseci prije
Reply to  Simon

Točno

pera lozac
Gost
pera lozac
2 mjeseci prije
Reply to  shumadinac

“Jer ljudi obolevaju, imaju vrlo specifične simptome koji nisu karakteristični za druge, slične bolesti. I umiru!”
Jes u pravu si, kako da ne.
Vidi cuda, GRIPA ima IDENTICNE SIMPTOME.

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  pera lozac

Gubitak čula ukusa i mirisa?
PAD LEUKOCITA???

štefica
Gost
štefica
2 mjeseci prije

pa od čega onda ljudi umiru?

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  štefica

Umiru manje nego prošle i pretprošle godine.
Kako vam već nije jasna ta prevara koja ide već 10 mjeseci?
Otvorite zadnjih 15ak članaka i potražite komentare od komentatora Istražuj, puki ili Legendarni Grk (isprika ostalim kontribuirajućim komentatorima, ova trojica su najkoherentniji), pa će vam biti jasnije.

Penzija
Gost
Penzija
2 mjeseci prije
Reply to  rimtu

Daj podatak za Hrvatsku

Penzija
Gost
Penzija
2 mjeseci prije
Reply to  Penzija

Reci mi sto mislis o tome sto je Sostar danas iznio podatke da nema vise gripe u Hrvatskoj

Zorule
Gost
Zorule
2 mjeseci prije
Reply to  Penzija

Evo, fali jos 11-i mjesec

https://imgur.com/FaFIt0w

Simon
Gost
Simon
2 mjeseci prije
Reply to  rimtu

Mislim kako se nemože u slučaju korone raspravljati snagom argumenata nego argumentom snage odnosno količinom ponavljanja poluistina i neistina.

CAN
Gost
CAN
2 mjeseci prije
Reply to  Simon

Dobar

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  rimtu

Kolega rimtu kaže “Umiru manje nego prošle i pretprošle godine”
Iz toga može da se zaključi da je korona lekovita – ako nastavi možda postanemo besmrtni 😉

mario
Gost
mario
2 mjeseci prije
Reply to  shumadinac

Ljudi umiru manje od kuge, iz toga možemo zaključiti da je kuga ljekovita? Odakle vadiš mudrosti

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  štefica

Situacija je mnogo bolja nego pre pola godine – tada bi na ovakav komentar stizale samo “čorvene”.

Dani
Gost
Dani
2 mjeseci prije
Reply to  štefica

Napisao sam ovo iznad imajući Vaše pitanje na umu pa ću ponoviti:
Izgleda da neka bolest ipak postoji (kakva, od kuda, ne znam, sve upućuje na gmo virus) kao i da postoji više lako dostupnih lijekova za nju (klorokin…). Ljudi umiru jer im je uskraćen tretman tim lijekovima i umjesto toga se stavljaju na respiratore od samog početka.

Dani
Gost
Dani
2 mjeseci prije
Reply to  Dani

Ne momčino, slučajno, kao i uvijek do sada u povijesti čovječanstava. Ti si očito zreo za sabor… uuuu…
P.S.🖕

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  Dani

I previše, ne trebaju nam i uvozni. 🙂
Imaš + za ovo.

Mikojan
Gost
Mikojan
2 mjeseci prije
Reply to  Dani

A ljudi se inače ubijaju slučajno, ono pazi Mirko metak, hvala Slavko !!
Eto, slučajno bi ga pogodio metak da ga drug nije upozorio na njega.
Za dug život trebaš dobrog druga a ne socijalnu distancu.

mirko
Gost
mirko
2 mjeseci prije
Reply to  Dani

Ne lupaj.

Simon
Gost
Simon
2 mjeseci prije
Reply to  štefica

Ljudi umiru od svega od čega su umirali poslijednih godina. Nije valjda kako umiru od chemtrailsa jer se nisu zaštitili aluminijskom folijom ili da umiru od korone jer ne nose maske oni i oni oko njih.

nonwo
Gost
nonwo
2 mjeseci prije
Reply to  štefica

Umiru od teških respiratornih infekata,upala pluća-virusnog i /ili bakterijskog porijekla.
Od kojeg virusnog infekta?Tko zna.
Ne traži se ni jedan drugi virusni uzročnik upala pluća osim sars cov2,a PCR koji “ga pronalazi” nije specifičan jer pronalazi sve i svašta -i živo i mrtvo.
Kliničke slike su prilično uniformne pa je jedan uzročnik očito prevladavajući,iako se ne može isključiti cirkuliranje gripe i drugih respiratornih virusa-kojima se nitko ne bavi.
Izoliranim ljudima smanjeno je dostupna zdravstvena zaštita što dovodi do mogućih zakidanja u pravovremenom liječenju.Bolnički protokol je upitan i po tvrdnji onih koji ga potpisuju-ne postoji lijek za covid.Ipak se propisuju lijekovi i primijenjuju protokoli uz nedokazanu učinkovitost i dokazane nuspojave.To također može povisiti smrtnost.
Financijska stimulacija bolnica koje pacijente stavljaju na respirator(cc 29 000 $ po pacijentu)moguće doprinosi smrtnosti zbog preagresivnog liječenja.

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  nonwo

13k za dijagnozu, 39k za respirator.
U Americi berba para bila i još uvijek je, na ubijanju ljudi respiratorima.

mirko
Gost
mirko
2 mjeseci prije
Reply to  štefica

Ne lupaj.

A neg.
Gost
A neg.
2 mjeseci prije

Ukratko, virus nije uzrok bolesti.
Vezano uz tzv. Kochove postulate pročitajte Stefana Lanka

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  A neg.

U samom tekstu piše da se Kohovi postulati ne primenjuju na viruse.

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  shumadinac

Pa da ih primjenjuju, ove prevare ne bi ni bilo.

Stock
Member
Famed Member
Stock
2 mjeseci prije
Reply to  shumadinac

Možda da se malo pročita… “SCV thus fulfils all of Koch’s postulates as the primary aetiological agent of SARS. This does not exclude the possibility that other pathogens, including human metapneumovirus (hMPV) and Chlamydia pneumoniae, may have exacerbated the disease in some SARS patients. However, these were not present in SCV-inoculated macaques (results not shown), were not found consistently in SARS patients, and do not usually cause the lesions associated with SARS. Moreover, lesions in macaques infected experimentally with hMPV isolated from a non-SARS individual7 were limited to mild suppurative rhinitis and minimal erosion in conducting airways, and disease was not exacerbated in two SCV-infected macaques subsequently inoculated with hMPV (results not shown).” Gugl prevod “SCV tako ispunjava sve Kochove postavke kao primarnog etiološkog agensa SARS-a. To ne isključuje mogućnost da su drugi patogeni, uključujući humani metapneumovirus (hMPV) i Chlamydia pneumoniae, mogli pogoršati bolest kod nekih bolesnika s SARS-om. Međutim, oni nisu bili prisutni u makakama inokuliranim SCV-om (rezultati nisu prikazani), nisu dosljedno pronađeni u bolesnika s SARS-om i obično ne uzrokuju lezije povezane s SARS-om. Štoviše, lezije u makakaima eksperimentalno inficiranim hMPV-om izoliranim od osobe koja nije SARS7 bile su ograničene na blagi suppurativni rinitis i minimalnu eroziju u vođenju dišnih… Pročitaj više »

nonwo
Gost
nonwo
2 mjeseci prije
Reply to  Stock

Vitamin D-definitivno DA.Da sad ne dužim,ima posvuda tekstova ,… svakako je začudna supstanca. U suradnji sa suncem nastaje u tijelu…to je već zanimljivo…
Zimi ga nedostaje,čak i kod nas…Sjevernjaci imaju kroničan manjak.
Imunostimulans,antitumorska aktivnost,zdravlje kostiju…

Piretis
Member
Piretis
2 mjeseci prije
Reply to  nonwo

Ako može jedna molba. Da ti i ostali koji nešto znate o tome napišete na jednom mjestu, jer ima toga dosta ali je rasuto, što podiže imunitet a moglo bi koristiti u ovom konkretnom slučaju.
P.S. Nije da na netu nema o tome ali je većim dijelom sa ciljem otimanja novca naivnim i prestrašenim.

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  Piretis

Čijim istraživanjima verovati? Neki ovde bi rekli “sve je to Rokfelerova kvazi nauka”…

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  shumadinac

Rekli pa pojasnili,ako misliš na istrazuj

Stock
Member
Stock
2 mjeseci prije
Reply to  Piretis

Ja klopam već nekoliko godina Division 800 mg D vitamin. I to je jedina tableta koju unosim.
A počeo sam, na savjet jednog Iračkog ortopeda, kada sam počeo dobijati bol u ledjima.
Do tada sam hodao kao polovna kurva od tada…kao…tek zaposlena.
Počnem u oktobru, kada počinju nordijske mrčine i završim u martu kada počinju dugi dani.
Pomaže!
Za ovu i sve druge jake viroze 4000 D vitamina, 5000 C vitamina i cink.
Dodatak….
Zaboravih reći da je taj ortoped to preporučio zato jer mi je tada nivo D vitamina bio 40, a neka normala je 80.

Kenjac
Gost
Kenjac
2 mjeseci prije
Reply to  Stock

800mg???

Stock
Member
Famed Member
Stock
2 mjeseci prije
Reply to  Kenjac

Divisun 800 ie se zove.
Ne 800 mg.
Sorry

Stock
Member
Stock
2 mjeseci prije
Reply to  nonwo

Prošle godine sam vodio projekat Osteoporoza. Dodatak D vitamina smo ubacili na svoju ruku.
Rezultat?
Još je rano za izvlačenje zaključaka, ali mislim da ćemo smanjiti lomove za najmanje 30%.

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  Stock

Hoćeš da kažeš da Logično prenosi neistine?

Stock
Member
Stock
2 mjeseci prije
Reply to  shumadinac

Čini mi se da smo (opet?) stvari shvatili svako na svoj način.

shumadinac
Gost
shumadinac
2 mjeseci prije
Reply to  Stock

Ti prenosiš tvrdnju: ““SCV tako ispunjava sve Kochove postavke kao primarnog etiološkog agensa SARS-a”

Logično kaže: “Virolozi tvrde da nije moguće “izolirati” virus jer se on replicira samo unutar stanica domaćina. Dodaju da se Kochovi postulati ne primjenjuju jer se odnose na bakterije (koje su živi organizmi)

Jeste kratak komentar ali sam ti ipak boldovao najvažnije – pa pošto ne umem da shvatim molio bih te da mi pomogneš. Ili bilo ko od onih što su shvatili i lajkovali tvoj komentar.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  shumadinac

Odnedavno? Po potrebi!?

A neg.
Gost
A neg.
2 mjeseci prije
Reply to  shumadinac

Gospon Š, Faktograf kaže da se primjenjuje i gle čuda Petar Vidov ga je vidio🤐

A neg.
Gost
A neg.
2 mjeseci prije
Reply to  shumadinac

Nisam pročitao ni naslov

karlo1
Gost
karlo1
2 mjeseci prije

Svi ti dokazi bili su jasni odavno.No sve je to đabe kada ljudi vjeruju medijima ovim glavnim i lete kao ovce na testiranje.

Kada su vidjeli kako se dobro zarađuje na testiranjima normalno da su nastavili dalje.Dokle god ljudi ne shvate i prestanu se ici testirati do tda ce i ovo trajati.

Kada nebi plašili narod nebi bilo testiranja kada nema testiranja nema brojki kada nema brojki nema ni mjera.

Samo kako to objasniti ljudima koji samo prate TV i cim se nakašlju lete se testirati i placaju masno test.

Dani
Gost
Dani
2 mjeseci prije

PCR test je od prilike kao da u kontejneru za stari papir prepunom printanih textova, sve iscijepano na sitne komadiće, tražite dokaz da je u njega bačeno jedno pismo printano na listu papira. Nađete neka slova od kojih bi traženo pismo moglo biti bar djelomično sastavljeno i tvrdite da je to dokaz da je u kontejner bačeno upravo to pismo.
I na temelju toga želite pola čovječanstava osuditi na smrt a pola na doživotnu robiju.
U zadnje vrijeme mi se budi optimizam i mislim da to na kraju ipak neće proći.
Koliko god da su ljudi u prosjeku glupi a polovica je gluplja od prosjeka, a zlikovci lukavi i močni, ipak je zlo destruktivno a život u suštini konstruktivan.
Možda Bog (što god to bilo, život?) ipak čuva nas prosječno dobroćudne budale…

NACISTISUSMRTNI
Gost
NACISTISUSMRTNI
2 mjeseci prije

“Treba suditi odgovornima za kazneno djelo zavjere radi počinjenja globalne prijevare. Ako budu proglašeni krivima, trebali bi biti zatvoreni, dok mi ostali nastavljamo s pokušajima popravljanja štete koju su već nanijeli.” AMEN!!

brzi
Gost
brzi
2 mjeseci prije

Treba suditi vama budalama teoteticarima zavjere

Mikojan
Gost
Mikojan
2 mjeseci prije
Reply to  brzi

brz na tipkama, spor u glavi. Hajde pogledaj onog ruskog teoretičara zavjere što je i kome je govorio, zanimljiva publika je bila a teoretičar zavjera. Bio ti je link neki dan, bilo bi dobro da ga netko ko zna ruski prevede da bude dostupniji širim masama pa i brzima.

mirko
Gost
mirko
2 mjeseci prije
Reply to  brzi

Ne lupaj.

mario
Gost
mario
2 mjeseci prije
Reply to  brzi

Mrš

Max
Member
Famed Member
Max
2 mjeseci prije

To je zločin bez daljneg,

hiber
Gost
hiber
2 mjeseci prije

Jebhe se virus za ovaj tekst, kao i za odluke stožera. On ide svojim putem. Uvijek treba razmotriti najjednostavniju opciju, pa tek onda one komplicirane. Kad bi neovisno o proturječnim informacijama što je svojstveno ratovima, promatrali stvarno stanje i posljedice onda bi najvjerojatnija i najjednostavnija opcija bila vođenje ograničenog biološkog rata. Sve ostalo je jednostavno prekomplicirano i više liči na zabijanje glave u pijesak. I Trump je zabio glavu u pijesak, pa je loše prošao.

Penzija
Gost
Penzija
2 mjeseci prije
Reply to  hiber

Pukovnik Kvackov je dao intervju o tome. Bio je zapovjednik vojne obavjestajne sluzbe pa valjda nesto zna

hiber
Gost
hiber
2 mjeseci prije
Reply to  hiber

Pravo pitanje je tko ratuje i protiv koga? Nuklearno oružje je za sada monopol teritorijalnih entita? Kad se nukleranog oružja dočepaju drugi, čut će se.

Mikojan
Gost
Mikojan
2 mjeseci prije
Reply to  hiber

Predstava u Kini je bila pokazna vježba, ako nas napadnete biološkim oružjima evo što smo u stanju napraviti za vrlo kratko vreme. A onda su lopticu prebacili na slobodni demokratki zapad i vidite što se dešava, godina dana agonije, propadanja gospodarstva, “raspad” zdravstvenih sustava (za javnost) i fantastičan posao prodaje kojekakvog smeća zvanog zaštitna sredstva protiv zaraze virusima za koje svakodnevno gledamo da nemaju nikakvu svrhu jer se bolesni pojavljuju svaki dan. Biološki napad na svijet i svi su gurnuli glavu u pijesak, da nisu već bi kinezi preventivno postreljali par svojih, kao, oprostite nismo znali što rade.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  hiber

Ovaj tvoj sažetak odgovara liku i djelu jedne imaginarne kreature, nastale miješanjem
bidona i krampa…
lako za njih,ali dokle ti misliš glavu zabijat u pijesak?dok je tvoja vlastita,svejedno mi…ali nemoj druge za sobom….
Drž’gaće!

mario
Gost
mario
2 mjeseci prije
Reply to  KISIK

Pusti ih, da se cjepe i maskiraju, slobodna volja!

hiber
Gost
hiber
2 mjeseci prije
Reply to  KISIK

Zabijam glavu u pijesak? Pred koronom ili zavjerom? Korona je zarazna bolest. U prošlom vremenima bila bi prirodna pojava, a sada kad se mnogi petljaju sa virusima mogu se postavljati određena pitanja i sumnje. Međutim odgovarati na pitanja općenitim teorijama zavjera sa milionima sudionika malo mi je nategnuto. Više mi to nalikuje na paranoju.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  hiber

Pred samim sobom i svojom djecom ,kojima si uzor!
Sudionika je par tisuća sa logistikom i lingvistikom,,ostali su pijuni-statisti.
Živ bio.

hiber
Gost
hiber
2 mjeseci prije
Reply to  KISIK

Sto sad djeca imaju s tim? Svaki dan srećem desetke koji su imali ne bas bezazlene oblike kovida i još se ti praviš pametan. Nekoliko ih je i umrlo. Nekako mi općenito baš djeca izgledaju pametno, pogotovo ova mlađa.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  hiber

Navrni na kavu pa ćemo pričat.

KISIK
Gost
KISIK
2 mjeseci prije
Reply to  hiber

Lažes sebe ili mene?
…i da pakšu,ja srećem 100.tine svaki dan.nikom ništa a zatvaraju ih tamo pred ekranr,da vide lice ljudsko makar na kompjutoru….može i animacija,.kamo dalje….
Rodijače!!??

mario
Gost
mario
2 mjeseci prije
Reply to  hiber

Uživajte pod pedofilom Bidenom i sotonističkim planovima

Pietro
Gost
Pietro
2 mjeseci prije
Reply to  hiber

Ti si ona budaletina sa VL,EU Janez.

Malimali
Gost
Malimali
2 mjeseci prije
Reply to  hiber

“najvjerojatnija i najjednostavnija opcija bila vođenje ograničenog biološkog rata”
Ovo sada je psyop, psihološki rat, koji se krije izza navodnog ograničenog biološkog rata. Gatesovo nastupanje u javnosti je relativno jasno.

Popadić
Gost
Popadić
2 mjeseci prije

Otkad sam dosao sa broda,dva puta se prehladio.Jebiga,padne imunitet na brodu,pa se lakse kupi.Nijednom mi nije palo ici na testiranje,ne sljivim sugavi sistem.Neke bi panika uhvatila…

ma daj
Gost
ma daj
2 mjeseci prije
Reply to  Popadić

Inace da bis se ukrcao na brod trebas PCR test,da bis letio avionom trebas test ne stariji od 48 sati,da bis usao u bilo koju zemlju trebas validni test..
Kako si ti sve to prosao?Brod te pokupio ispred kuce?
Ili si u domacoj plovidbi?

Bond, cigarete Bond
Gost
Bond, cigarete Bond
2 mjeseci prije

Nego, preboli li iko ovu koronu sa portala?
Moji ukućani i ja jesmo.
Ćerka najmlađa imala 1 dan temp i glavobolju,
Žena 2 dana glavobolja, temp a kašalje i nakon 10 dana. Leukociti niski, rtg pluća hmm, ima nešto. Umori se brzo. Nema mirisa ni okusa. Dobila danas sumamed.
Ja 3 dana temp, glava i kašljucanje, izgubio miris. Kašljucam i nakon 10 dana, i ne mogu uz stepenice. Umor.
Uglavnom drago nam je da smo to riješili.

Lopata
Gost
Lopata
2 mjeseci prije

Sve te simpome je cijela moja obitelj imala kraj siječnja, početak veljače.

Nego,

Kakav to virus uzrokuje upale a da su leukociti sniženi??? Znači umreš od upale pluća zbog korone, a leukociti umjesto da skočili do neba, niski bili? Ima koji pametni da zna odgovor što uzrokuje da leukociti padnu?

Coca Corona
Gost
Coca Corona
2 mjeseci prije
Reply to  Lopata

Ima,vidi rad srpske lečnice…i komentare o mogućim razlozima na ovom portal od pre par dana,traži sam za promijenu…

Coca Corona
Gost
Coca Corona
2 mjeseci prije
Reply to  Coca Corona

Ali što mi je još kod ove priče oko takozvane korone zanimljivo,a to je što je rekla prof.dr.Nada Kostić, da kod oboljelih pada razina leukocita do ispod donje granice normale. Dakle,kod virusnih i bakterijskih infekcija leukociti uvijek rastu visoko. I doktori početnici to znaju. Oni ljudi koje poznajem i koji su oboljeli ,to su mi potvrdili,da su im leukociti pali ispod normale.
Pitanje je zašto takozvana korona izaziva pad leukocita? Leukociti padaju u dva slučaja.
Prvi je kod otrovanja organizma radijacijom ili drugim otrovima,a drugi razlog su autoimune bolesti,npr.Herpes,Velike Boginje,Tifus,AIDS.
Prof.dr.Kostić smatra da ljudi umiru zbog trovanja zračenjima od 5G i zbog nanočestica aluminijuma iz aviona koji nas godinama zasipaju,te da se sve kamuflira ovom virozom,te da će cjepivo biti vrhunac umiranja. Tako kaže prof.dr.Kostić.
S druge strane francuski nobelovac je izjavio da je ovo hibrid AIDSa i korona virusa.
I jedno i drugo tumačenje objašnjava pad leukocita ,dakle stvar nije bezazlena. A cjepljenjem će se ljudi genetski modificirati,jer ova cjepiva mjenjaju strukture DNKa,tako da bi po tumačenju prof.dr. Nade Kostić kroz godinu do deset godina svi koji prime cjepivo bi umrli,a neki mlađi bi reproducirali djecu s velikim deformacijama.
ETO LIJENČUGO.

Lopata
Gost
Lopata
2 mjeseci prije
Reply to  Coca Corona

Bingo!

Malimali
Gost
Malimali
2 mjeseci prije
Reply to  Coca Corona

Primjedba: velike boginje ili tifus nisu autoimuna bolest.

Stock
Member
Famed Member
Stock
2 mjeseci prije

Moja kćer je zaglavila u bolnici 10 dana. Upala pluća, naravno kovid, sta drugo.
3 dana na odjelu izmedju “običnog ” bolničkog lječenja i intenzivne.
Dobro zajebana upala.
Danas je pustili kući.
Žena prije 7-8 dana fasuje temperaturu, ali mi ne govori sve do nazad 3 dana.
Danas i nju odvedem kod doktora…upala pluća. Evo je leži i manta. Nikako ozdraviti.
Ja…
Biće da sam tako pogan da me ni virus neće. Iako sam u bolnici sa kćerkom proveo 4 dana i noći neprestano.
Ne znam…

rimtu
Gost
rimtu
2 mjeseci prije
Reply to  Stock

Ako napišem zato kaj nije zarazno, neće mi puno ljudi vjerovat.

hiber
Gost
hiber
2 mjeseci prije
Reply to  Stock

Naprosti si imun. Kako, to je pitanje složenosti imuniteta? Što ne znači da ćeš u drugim okolnostima to ponovo biti. Pitanje koje postavljaš postavljalo se tisućama godina, samo smo zaboravili da ga postavljamo u posljednje vrijeme.

Simon
Gost
Simon
2 mjeseci prije

Ja takve korone imam 1 – 2 puta godišnje. Najgora korona me je zahvatila početkom 2016 godine i trajala je 50 dana.

Simon
Gost
Simon
2 mjeseci prije
Reply to  Simon

Srećom ove godine nisam dobio koronu.

Jomla
Gost
Jomla
2 mjeseci prije

Psihijatri su najuspješniji među doktorima: njihovi pacijenti vladaju svijetom!

... ....
Gost
... ....
2 mjeseci prije

Znači, ako uopće ima ičeg novog.. dok ekipa izrealizira neke svoje projekte koji zračenjem ugrožavaju one slabije trebaju neko opravdanje za to nastalo sr…

Legendarni Grk
Gost
Legendarni Grk
2 mjeseci prije

Prirodni antibiotik Ovaj recept je prije nekoliko godina pomogao jednom starijem čovjeku od 83 godine kod trovanja hranom na nekom javnom okupljanju. Podmetnuli su im staru ribu i gotovo svi su završili u bolnici, dijagnoza HelicoBacter Pylori, Botulinus, teško trovanje probavnog sustava. Povraćao je nakon pola sata sve što bi pojeo ili popio i uplašio se da je gotov i da će umrijeti. Tri službena medicinska antibiotika koje je dobio prilikom boravka u bolnici mu nisu mogla pomoći, a tamo je dobio i infuziju – onda su ga pustili kući, recept: gladovanje. Zbog svega toga je izgubio nekoliko kilograma, ali nije ozdravio. Mi smo baš napravili novu porciju tog antibiotika, pa sam mu slijedeći dan odnio pola bočice, da proba i da vidimo kako će djelovati. Ovaj prirodni antibiotik je za samo jedan dan – dvije male žlice prije podne i dvije poslije podne – uklonio povraćanje i nakon toga je normalno mogao jesti i piti, kao da se ništa nije dogodilo. Sada je s 85 godina živ i zdrav i povremeno radi pauzu od uzimanja ovog prirodnog antibiotika. Sastojci: 2 žličice svježe naribanog đumbira 1 češanj češnjaka pola žličice mljevene čili paprike pola žličice cimeta 2 žličice meda 1… Pročitaj više »

Lopata
Gost
Lopata
2 mjeseci prije
Reply to  Legendarni Grk

PROPOLIS! 5 dana u tjednu 20 kapi 20% ili 15 kapi od 35%. dva dana odmora za vikend!

CAN
Gost
CAN
2 mjeseci prije
Reply to  Legendarni Grk

P.S. koristitu plastičnu žlicu.

dulebg
Gost
dulebg
2 mjeseci prije

Kao da postoje 2 zaraze: jedan laki grip, a drugo – nešto bakterijski ili na bazi bojnog otrova sarina. Pa šta koga dopadne?

Nema Ime
Gost
Nema Ime
2 mjeseci prije

Debeli Djuro je onaj supak is faktografa mad nemoze osporit onda trola

mislav
Gost
mislav
2 mjeseci prije

Isti zaključak mogao bi napisati svaki iole pametniji majmun. Nije problem u smrtnosti jer je zaista mala, nego u zauzimanju bolničkih kapaciteta tako da ostali bolesnici, pogotovo kronični, ne mogu ni prismrditi bolnici več skoro 10 mjeseci.

POVEZANE VIJESTI