
Covid 19 – Dokaz svjetske prevare

Covid 19

Čini se da su COVID 19 kao i kasnije reakcije vlada dio međunarodne zavjere za počinjenje prijevare. Čini se da nema dokaza da virus nazvan SARS-CoV-2 uzrokuje bolest zvanu COVID 19.

Ponekad morate imati žicu. Nisam stručnjak za genetiku i, kao i uvijek, toleriram ispravke. No moju su pažnju privukla neka istraživanja objavljena u španjolskom medicinskom časopisu D-Salud-Discovery. Njihov savjetodavni odbor visoko kvalificiranih liječnika i znanstvenika daje dodatnu vjerodostojnost njihovim istraživanjima. Njihova je tvrdnja zapanjujuća.

Genetski primeri i sonde korišteni u RT-PCR testovima za identifikaciju SARS-CoV-2 ne ciljaju ništa određeno. Slijedio sam tehnike pretraživanja navedene u ovom engleskom prijevodu njihovog izvještaja i mogu potvrditi točnost njihovih tvrdnji o nukleotidnim sekvencama navedenim u protokolima Svjetske zdravstvene organizacije. Možete i vi učiniti isto.

D-Salud-Discovery tvrdi da ne postoje testovi koji bi mogli identificirati SARS-CoV-2. Slijedom toga, sve su tvrdnje o navodnom utjecaju COVID 19 na zdravlje stanovništva neutemeljene.

Cjelokupna službena pripovijest o COVIDU 19 je obmana. Navodno, ne postoji znanstveni temelj ni za jedan njegov dio.

Ako su ove tvrdnje točne, možemo ustvrditi da ne postoje dokazi o pandemiji, već samo privid jedne. Trpjeli smo nesagledivi gubitak bez ikakvog očitog razloga, osim ambicija beskrupuloznih despota koji žele transformirati globalno gospodarstvo i naše društvo u skladu sa svojim svrhama.

Pritom je ova “parazitska klasa” potencijalno počinila bezbroj zločina. Ti se zločini mogu i trebaju istražiti i procesuirati na sudu.


Svjetska zdravstvena organizacija (WHO) klasificirala je COVID-19 (COronaVIrus Disease 2019). Proglasili su globalnu pandemiju COVID 19 11. ožujka 2019.

Covid 19 – Dokaz svjetske prevare 1

Smjernice laboratorijskog ispitivanja SZO-a navode:

„Etiološki uzročnik [uzročnik bolesti] odgovoran za klaster slučajeva upale pluća u Wuhanu identificiran je kao novi betakoronavirus, (u istoj obitelji kao SARS-CoV i MERS-CoV) putem sekvenciranja sljedeće generacije (NGS) iz uzgajanog virusa ili izravno iz uzoraka primljenih od nekoliko oboljelih od upale pluća.”

Tvrdnja SZO-a je da virus SARS-CoV-2 uzrokuje bolest COVID-19. Također tvrde da su istraživači iz Wuhana jasno identificirali ovaj virus.

U WHO-ovom izvještaju Novel Coronavirus 9-nCov Situation Report1, navode:

Kineske vlasti identificirale su novu vrstu koronavirusa, koji je izoliran 7. siječnja 2020.…. 12. siječnja 2020. Kina je podijelila genetski slijed novog koronavirusa zemljama koje će ga koristiti u razvoju specifičnih dijagnostičkih kompleta.”

Ove dvije izjave SZO-a jasno sugeriraju da je virus SARS-CoV-2 izoliran (što znači pročišćen za proučavanje), a zatim su identificirane genetske sekvence iz izoliranog uzorka. Od toga su razvijeni dijagnostički kompleti koji su globalno distribuirani za testiranje virusa u gradovima i zajednicama širom svijeta. Prema WHO-u i kineskim istraživačima, ovim će se testovima pronaći virus koji uzrokuje COVID 19.

Ipak, SZO također navodi:

„Radeći izravno iz informacija o sekvencama, tim je razvio niz testova genetske amplifikacije (PCR) koje koriste laboratoriji.”

Znanstvenici iz Wuhana razvili su svoje testove genetske amplifikacije iz “informacija o sekvencama” jer nije bilo izoliranog, pročišćenog uzorka takozvanog virusa SARS-CoV-2. Također su pokazali slike elektronskog mikroskopa novootkrivenih viriona (šiljasta proteinska kugla koja sadrži virusnu RNA.)

Međutim, takve proteinske strukture nisu jedinstvene. Izgledaju poput ostalih okruglih vezikula, poput endocitnih mjehurića i egzozoma.

Covid 19 – Dokaz svjetske prevare 2

Virolozi tvrde da nije moguće “izolirati” virus jer se on replicira samo unutar stanica domaćina. Dodaju da se Kochovi postulati ne primjenjuju jer se odnose na bakterije (koje su živi organizmi). Umjesto toga, virolozi promatraju citopatogene učinke virusa (CPE), uzrokujući mutaciju i razgradnju stanica u staničnim kulturama.

Kada su kineski istraživači prvi put sekvencirali puni genom SARS-CoV-2, primijetili su CPE u stanicama Vero E6 i Huh7. Vero E6 su ovjekovječene stanice majmuna, a Huh7 su ovjekovječene stanice raka (tumorske). Što znači da se održavaju in vitro (u kulturama Petrijevih zdjelica) dugi niz godina.

Za službenu priču o SARS-CoV-2 središnja je ideja da je to zoonotski virus, sposoban premostiti jaz između vrsta i životinja. Kad su znanstvenici iz američkog CDC-a “zarazili” nove stanice novim virusom, primijetili su sljedeće:

Ispitali smo sposobnost SARS-CoV-2 da zarazi i umnoži se u nekoliko zajedničkih linija primata i ljudskih stanica, uključujući stanice ljudskog adenokarcinoma (A549) [plućne stanice], stanice ljudske jetre (HUH7.0) i stanice ljudskog embrija ( HEK-293T), uz Vero E6 i Vero CCL81 [stanice majmuna] … Nije primijećen citopatski učinak ni u jednoj staničnoj liniji, osim u Vero stanicama [stanice majmuna] … Stanice HUH7.0 i 293T pokazale su samo skromnu virusnu replikaciju i Stanice A549 [stanice ljudskog plućnog tkiva] bile su nespojive s infekcijom SARS-CoV-2.”

CDC nije primijetio CPE u ljudskim stanicama. Nisu vidjeli dokaze da je ovaj navodni virus prouzročio bilo kakvu ljudsku bolest. Niti ovaj navodni ljudski virus nije pokazao značajnu replikaciju u ljudskim stanicama, što sugerira da bi infekcija od čovjeka do čovjeka bila nemoguća.

Primijetivši ovaj problem, tim poljskih znanstvenika uveo je ovaj sekvencionirani “virus” u stanice ljudskog epitela (dišnih putova). Promatrali su učinke na ove HAE kulture tijekom 5 dana. Primijetili su mnogo veću reprodukciju od znanstvenika CDC-a, ali na kraju su izjavili:

“Nismo primijetili nikakvo oslobađanje virusa s bazolateralne strane HAE kulture.”

Što znači da nisu vidjeli nikakve dokaze da su navodni virioni probili membranu staničnog zida. Opet sugerirajući da ovaj takozvani virus nije zarazan za ljude.

Nije jasno da li je SARS-CoV-2 ljudski virus koji može uzrokovati bolest. Možda čak i fizički ne postoji. Nije li to ništa drugo do koncept zasnovan na prediktivnim genetskim sekvencama?

covid19 struktura


Centar za kontrolu i prevenciju bolesti Wuhan i Klinički centar za javno zdravstvo u Šangaju objavili su prvi cjeloviti genom SARS-CoV-2 (MN908947.1). Ovo je mnogo puta ažurirano. Međutim, MN908947.1 je prva genetska sekvenca koja opisuje navodni etiološki agens COVID 19 (SARS-CoV-2).

Svi sljedeći zahtjevi, ispitivanja, liječenja, statistika, razvoj cjepiva i politike koje su rezultirale iz toga, temelje se na ovom slijedu. Ako testovi za ovaj novi virus ne identificiraju ništa što bi moglo izazvati bolest kod ljudi, cijela pripovijest o COVIDU 19 nije ništa drugo do šarada.

Istraživači WUHANA izjavili su da su učinkovito spojili genetsku sekvencu SARS-CoV-2 poklapajući fragmente pronađene u uzorcima s drugim, prethodno otkrivenim genetskim sekvencama. Od prikupljenog materijala pronašli su 87,1 % podudaranja sa SARS koronavirusom (SARS-Cov). Koristili su de novo sklop i ciljani PCR i pronašli 29.891-bazni par koji dijeli 79,6 % podudaranja sekvence sa SARS-CoV.

Morali su se koristiti de novo sklopom jer nisu imali apriorno znanje o ispravnom slijedu ili redoslijedu tih fragmenata. Jednostavno, izjava SZO-a da su kineski istraživači izolirali virus 7. siječnja je lažna.

Tim iz Wuhana upotrijebio je 40 rundi RT-qPCR amplifikacije kako bi uskladio fragmente cDNA (komplementarna DNA izrađene od uzorkovanih fragmenata RNA) s objavljenim genomom koronavirusa SARS (SARS-CoV). Nažalost, nije jasno ni koliko je točan izvorni SARS-CoV genom.

2003. godine tim istraživača iz Hong Konga proučavao je 50 pacijenata s teškim akutnim respiratornim sindromom (SARS). Uzeli su uzorke od 2 pacijenta i razvili kulturu u stanicama jetre fetusa majmuna.

Stvorili su 30 klonova genetskog materijala koji su pronašli. Nisu uspjeli pronaći dokaze ni o jednom drugom poznatom virusu, u samo jednom od ovih kloniranih uzoraka pronašli su genetske sekvence “nepoznatog podrijetla”.

Covid 19 – Dokaz svjetske prevare 3

Ispitujući ove nepoznate sekvence RNA, utvrdili su da se 57% podudara s goveđim koronavirusom i virusom mišjeg hepatitisa i zaključili su da je iz obitelji Coronaviridae. S obzirom na to da ove sekvence sugeriraju novootkriveni virus SARS-CoV (nova otkrića su ambrozija (piće bogova) za znanstvenike), dizajnirali su RT-PCR početnice za testiranje na ovaj novi virus. Istraživači su izjavili:

„Primeri za otkrivanje novog virusa dizajnirani su za RT-PCR detekciju ovog genoma koronavirusa povezanog s upalom pluća u kliničkim uzorcima. Od 44 uzorka nazofarinksa dostupnih od 50 pacijenata sa SARS-om, 22 je imalo dokaze o koronavirusnoj RNA povezanoj s ljudskom upalom pluća. “

Polovica testiranih pacijenata, koji su svi imali iste simptome, bila je pozitivna na ovaj novi navodni virus. Nitko ne zna zašto je druga polovica testirana negativno na ovaj novi virus SARS-CoV. Pitanje nije postavljeno.

Ovaj navodni virus imao je samo 57% podudaranja sekvence s navodno poznatim koronavirusom. Ostalih 43% bilo je samo “tamo”. Sekvencirani podaci proizvedeni su i zabilježeni kao novi genom kao GenBank pristupni broj AY274119.

Istraživači iz Wuhana naknadno su pronašli 79,6% podudaranja sekvence s AY274119 i stoga su ga nazvali novim sojem SARS-CoV (2019-nCoV – na kraju preimenovan u SARS-CoV-2). Nitko ni u jednoj fazi ovog postupka nije proizveo izolirani, pročišćeni uzorak bilo kojeg virusa. Sve što su imali bila su postotna podudaranja niza s ostalim postotnim podudaranjima.


Znanstvenike jako nervira jer neprestano govore da je virus izoliran, ali im nitko ne vjeruje. To je zato što još uvijek nitko nije pružio niti jedan pročišćeni uzorak virusa SARS-CoV-2. Umjesto toga imamo dovršeni genom i, kao što ćemo tek otkriti, nije osobito uvjerljiv.

Novinari istražitelji Torsten Engelbrecht i Konstantin Demeter zamolili su neke znanstvenike koji su rekli da imaju slike viriona SARS-C0V-2 da potvrde da se radi o slikama izoliranog, pročišćenog virusa. Nitko od njih nije mogao.

U Australiji su znanstvenici s Instituta Doherty objavili da su izolirali virus SARS-CoV-2. Na pitanje da pojasne, znanstvenici su rekli:

“Imamo kratke (RNA) sekvence iz dijagnostičkog testa koje se mogu koristiti u dijagnostičkim testovima”

To objašnjava zašto australska vlada navodi:

„Pouzdanost testova na COVID-19 je neizvjesna zbog ograničene baze dokaza … Dostupni su ograničeni dokazi za procjenu točnosti i kliničke korisnosti dostupnih testova na COVID-19. “

U Velikoj Britaniji, u srpnju, grupa zabrinutih akademika napisala je pismo britanskom premijeru Borisu Johnsonu u kojem su ga zamolili da:

„da izraditi neovisne stručne recenzije znanstvenih dokaza koji dokazuju da je virus Covid-19 izoliran.”

Do danas nisu dobili odgovor.

Slično tome, britanski istraživač Andrew Johnson podnio je zahtjev za pristup informacijama za javno zdravstvo Engleske (PHE). Zamolio ih je da mu dostave svoje zapise koji opisuju izolaciju virusa SARS-COV-2. Na što su oni odgovorili:

„PHE može potvrditi da ne sadrži podatke na način predložen vašim zahtjevom.“

Kanadska istraživačica Christine Massey podnijela je sličan zahtjev za slobodom informacija tražeći isto od kanadske vlade. Na što je kanadska vlada odgovorila:

„Nakon temeljite pretrage sa žaljenjem vas obavještavamo da nismo uspjeli pronaći nijedan zapis koji odgovara vašem zahtjevu.“

U SAD-u Centar za kontrolu bolesti (CDC) RT-PCR Dijagnostički panel navodi:

„… Trenutno nisu dostupni kvantificirani izolati virusa 2019-nCoV …… .. Otkrivanje virusne RNA možda ne ukazuje na prisutnost zaraznog virusa ili da je 2019-nCoV uzročnik kliničkih simptoma.”

Posljednje ažuriranje 13. srpnja 2020. godine, CDC tek treba dobiti bilo koji čisti virusni uzorak od bilo kojeg pacijenta za kojeg se kaže da ima bolest COVID-19. Otvoreno priznaju da njihovi testovi ne pokazuju nužno je li SARS-CoV-2 prisutan ili uzrokuje COVID 19.

Kažu nam da ništa od toga nije važno. Da smo neuki i jednostavno ne razumijemo virologiju. Stoga moramo prihvatiti slike stvari za koje znamo da bi mogle biti nešto drugo i genetske sekvence (koje bi mogle biti bilo što drugo) kao konačni dokaz da su ovaj virus i bolest koju bi trebao uzrokovati stvarni.

Covid 19 – Dokaz svjetske prevare 4


SZO i svaka vlada, think tank, odbor za upravljanje politikama, vladin znanstveni savjetnik, nadnacionalne institucije i drugi koji promoviraju službenu pripovijest o COVID 19, tvrde da SARS-CoV-2 uzrokuje COVID 19.

Iako nitko nikada nije proizveo uzorak ovog navodnog virusa, objavljen je navodni genom SARS-CoV-2. U javnosti je.

Kaže se da ključne genetske sekvence u genomu SARS-CoV-2 imaju specifične funkcije. To su ciljani proteini na koje znanstvenici testiraju kako bi identificirali prisutnost “virusa”. To uključuje:

  • Gen za RNA-polimerazu (Rd-Rp) – To omogućuje SARS-CoV-2 RNA da se replicira unutar citoplazme epitelnih stanica oboljelih od COVID 19.
  • S gen (Orf2) – ovaj glikoprotein tvori šiljak na površini viriona SARS-CoV-2 što navodno olakšava vezivanje SARS-CoV-2 za ACE2 receptore na stanicama, omogućujući RNK unutar proteinske ljuske viriona (kapsida) da pređe u sada zaraženu
  • E gen (Orf1ab) – mali membranski protein koji se koristi u sastavljanju virusa
  • N gen (Orf9a) – nukleokapsidni gen koji veže RNA u formaciju kapside

SZO održava javno dostupnu evidenciju RT-PCR primera i sondi korištenih za ispitivanje SARS-CoV-2. Primeri su specifične nukleotidne sekvence koje se vežu na antisense i osjetne niti sintetizirane cDNA.

Niti cDNA razdvajaju se pri zagrijavanju i reformiraju kad se hlade. Prije hlađenja, nukleotidne sekvence nazvane probe uvode se u kaljenja na specifična ciljna područja sumnjivog virusnog genoma. Tijekom pojačavanja, kako se područja između početnih slojeva izdužuju, kada primer udari u probu, proba propada oslobađajući fluorescentnu boju ili boju koju istraživači mogu pročitati.

Identifikacija ovih markera je ono za što znanstvenici tvrde da dokazuje prisutnost SARS-CoV-2 u uzorku.

Nešto drugo što je javno dostupno je Osnovni alat za pretraživanje lokalnog usklađivanja (BLAST). To omogućuje svima da uspoređuju objavljene nukleotidne sekvence sa svim onima koje pohranjuje genetska baza podataka Nacionalnog instituta za zdravlje (NIH) pod nazivom GenBank. Stoga možemo BLASTIRATI navodne SARS-CoV-2 početnice, sonde i ciljne sekvence gena.

SZO-ovi protokoli za nizvodne i uzvodne primere i probe, za navodni virusni genom SARS-CoV-2, temelje se na profilima gena RdRp, Orf1, N i E. Svatko ih može provući kroz BLAST da vidi što smo pronašli.

Vitalna RdRP nukleotidna sekvenca, koja se koristi kao primer, je – ATGAGCTTAGTCCTGTTG. Ako pokrenemo nukleotidni BLAST, to se bilježi kao potpuni izolat SARS-CoV-2 sa 100% podudarnim identitetom sekvence. Slično tome, uzvodna sekvenca početnog gena E primera – ATATTGCAGCAGTACGCACACA – otkriva prisutnost sekvence Orf1ab koja također identificira SARS-CoV-2.

Međutim, BLAST nam također omogućuje pretragu nukleotidnih sekvenci mikrobnih i ljudskih genoma. Ako pretražimo RdRp SARS-CoV-2 sekvencu, otkriva se 99 ljudskih kromosoma sa 100% podudaranjem identiteta sekvence. Orf1ab (E gen) vraća 90 sa 100% podudaranjem identiteta sekvence na ljudske kromosome.

Radeći isto za ove sekvence mikrobiološkom pretragom, pronalazi se 92 mikroba sa 100% podudaranjem s genom SARS-CoV-2 E i 100 podudarnih mikroba, sa 100% identitetom sekvence, vitalnim SARS-CoV-2 RdRp genom.

Kad god provjerimo takozvane jedinstvene genetske markere za SARS-CoV-2, zabilježene u protokolima SZO, nalazimo potpuno ili visoko postotno podudaranje s raznim fragmentima ljudskog genoma. To sugerira da genetske sekvence koje bi trebale identificirati SARS-CoV-2 nisu jedinstvene. Oni mogu biti bilo što, od mikrobnih sekvenci do fragmenata ljudskih kromosoma.

Takozvani provjeravači činjenica, poput Reutersova projekta Health Feedback, brzo su odbacili tvrdnje onih koji su primijetili očigledan nedostatak specifičnosti u navodnom genomu SARS-CoV-2.

Koristeći mnoštvo izvrnutih argumenata poput: “ova tvrdnja sugerira da bi svaki test trebao biti pozitivan” (što nije istina) njihov pokušaj diskreditiranja ide otprilike ovako:

„Primeri su dizajnirani da se vežu za specifične nukleotidne sekvence koje su jedinstvene za virus. Nizvodni primer se može vezati za određeni kromosom, ali uzvodni primer ne veže se za isti kromosom, pa kromosom nije prisutan u virusu SARS-CoV-2. Štoviše, budući da nizvodni i uzvodni primeri obavijaju sekvencu koji se pojačava, cDMA sekvenca između primera jedinstvena je za virus.“

Čini se da ovo namjerno pogrešno predstavlja značaj ovih nalaza iznoseći argument koji nitko, osim samih provjeravatelja činjenica, ne iznosi. BLAST pretraživanja pokazuju da ove ciljne sekvence nisu jedinstvene za SARS-CoV-2. Niti je potrebno pronaći sve ciljeve da bi se rezultat smatrao pozitivnim.

Marokanski istraživači istraživali su epidemiologiju marokanskih navodnih slučajeva SARS-CoV-2. Devet posto bilo je pozitivno za tri gena, osamnaest posto bilo je pozitivno za dva gena, a sedamdeset i tri posto za samo jedan. Kao što smo upravo razgovarali, mnogi su možda bili pozitivni ni za jednog.

To je u potpunosti u skladu sa smjernicama SZO-a za ispitivanje. Oni navode:

„Optimalna dijagnoza sastoji se od NAAT [test pojačavanja nukleinske kiseline] s najmanje dva cilja neovisna o genomu SARS-CoV-2; međutim, u područjima gdje je prijenos široko rasprostranjen, može se koristiti jednostavni algoritam s jednim ciljem …… Jedan ili više negativnih rezultata ne isključuju nužno infekciju SARS-CoV-2. ”

Bez obzira na lažne argumente dobro financiranih provjeravatelja činjenica, ako nizvodni i uzvodni primeri identificiraju smeće, možda je jedno fragment kromosoma, a drugo mikrobna sekvenca, onda je i pojačano područje između njih vjerojatno smeće.

Argument da RT-PCR pronalazi samo RNA je nepresušan. Prirodna transkripcija (odvajanje DNA lanaca) događa se tijekom ekspresije gena. Nitko ne govori da su čitavi kromosomi ili mikrobi sekvencirani u navodnom genomu SARS-CoV-2. Iako mogu, koliko znamo. Kažu da navodni markeri koji se koriste za testiranje ovog navodnog virusa nisu prikladni za tu svrhu.

Covid 19 – Dokaz svjetske prevare 5

RT-PCR testovi ne slijede čitav genom. Oni traže incidente specifične fluorescencije probe kako bi ukazali na prisutnost sekvenci za koje se tvrdi da postoje. Te su sekvence definirane s MN908947.1 i sljedećim ažuriranjima. Ovi početnici i probe nisu mogli otkriti ništa osim podudaranja RNA izvučenih iz nekodiranja, ponekad zvanog “smeće”, DNA (cDNA.)

Na primjer, gen SARS-CoV-2 S treba biti visoko specifičan za genom virusa SARS-CoV-2. Ciljni slijed je – TTGGCAAAATTCAAGACTCACTTTC. Mikrobiološko pretraživanje BLAST vraća 97 podudaranja mikroba sa 100% podudaranjem sekvence identiteta. Najniži postotak podudaranja identiteta, među prvih 100, iznosi 95%. Ljudski genom BLAST također pronalazi 100% podudaranje sekvence s 86 fragmenata humanog kromosoma.

Bez obzira gdje pogledali u navodnom genomu SARS-CoV-2, u testnim protokolima SZO nema ničega što jasno identificira o čemu se radi. Cijeli genom mogao bi biti lažan. Ispitivanja ne dokazuju postojanje SARS-CoV-2. Sve što otkrivaju je juha od nespecificiranog genetskog materijala.

Ako je tako, budući da nema izolata ili pročišćenih uzoraka virusa, bez održivog testa, nema dokaza da postoji SARS-CoV-2. Stoga niti ne postoje dokazi da postoji bolest nazvana COVID 19.

To dovodi do zaključka da ne postoji znanstvena osnova za bilo kakve tvrdnje o brojevima slučajeva COVID 19, hospitalizacijama ili smrtnosti. Sve mjere poduzete u borbi protiv ovog smrtonosnog virusa zasnivaju se na ničemu.


Prijevara je kazneno djelo. Zakonska definicija prijevare je:

“Neki obmanjujući postupci ili plan s namjerom da se drugom oduzme pravo ili mu se na neki način nanese ozljeda.”

Pravna definicija zavjere je:

“Kombinacija ili savez između dvije ili više osoba nastao radi zajedničkog napora počinjenja nekog nezakonitog ili kaznenog djela”

Čini se da oni koji tvrde da se suočavamo s pandemijom nisu pružili nikakve dokaze da virus nazvan SARS-CoV-2 uzrokuje bolest zvanu COVID 19. Sve informacije koje snažno sugeriraju ovu mogućnost lako su dostupne u javnoj domeni. Svatko ih može pročitati.

Da bi došlo do prijevare, prijevara mora biti namjerna. Namjera mora biti namjerno oduzimanje prava drugima ili ozljeđivanje na neki drugi način. Ako postoje dokazi o dosluhu između pojedinaca i / ili organizacija radi počinjenja prijevare, onda je to zavjera (u jurisdikcijama Common Lawa) ili Udruženi zločinački pothvat (UZP) prema međunarodnom pravu.

Čini se da je COVID 19 namjerno korišten kao casus belli za ratovanje s čovječanstvom. Zatvoreni smo u vlastite domove, ograničena nam je sloboda kretanja, narušena sloboda govora i izražavanja, ukinuto pravo na prosvjed, odvojeni od voljenih, poslovanje uništeno, psihološki bombardirano, maskirano i terorizirano.

Još gore, iako nema dokaza o neviđenoj smrtnosti od svih uzroka, bilo je nerazumnih skokova u smrtnosti. Oni koreliraju s mjerama zaključavanja koje su rezultirale povlačenjem zdravstvenih usluga koje plaćamo i preusmjeravanjem javnih zdravstvenih službi na liječenje jedne navodne bolesti, isključujući sve druge.

Nadalje, oni koji su proslijedili priču o COVID 19 predlažu da ova navodna bolest daje opravdanje za cjelovito restrukturiranje globalne ekonomije, naših političkih sustava, društava, kultura i samog čovječanstva.

Da bi im se omogućilo sudjelovanje u njihovoj takozvanoj “novoj normalnosti“, koja je veleprodajna transformacija cijelog našeg društva bez našeg pristanka, inzistiraju da se podvrgnemo njihovim uvjetima.

To uključuje, ali nije ograničeno na, biometrijski nadzor svih, centraliziranu kontrolu i nadzor svih naših transakcija, opresivna poslovna i socijalna ograničenja te efektivne zahtjeve da nemamo pravo na suverenitet nad vlastitim tijelima. Ovo predstavlja uvjet ropstva.

Nema sumnje da smo lišeni prava i da nam je nanešena povreda. U jurisdikcijama Common Lawa pretpostavlja se nevinost, ali dokaza da je međunarodna zavjera namjerno prouzročila štetu ima napretek. Destruktivne politike, koje su donijele vlade širom svijeta, očito su nastale među globalističkim think tank-ovima i nadnacionalnim institucijama mnogo prije pojave ove nepostojeće pandemije.

U jurisdikcijama Napoleonovog zakonika pretpostavlja se krivnja. Da bi optuženi zavjerenici dokazali svoju nevinost moraju pokazati da, unatoč svojim neizmjernim resursima, kolektivno nisu mogli pristupiti niti razumjeti bilo koji od slobodno dostupnih dokaza koji sugeriraju da je COVID 19 mit.

Treba suditi odgovornima za kazneno djelo zavjere radi počinjenja globalne prijevare. Ako budu proglašeni krivima, trebali bi biti zatvoreni, dok mi ostali nastavljamo s pokušajima popravljanja štete koju su već nanijeli.

Izvor: off-guardian.org


Vrijeme uvjeravanja prolazi. One koji ne shvaćaju što se događa, treba ignorirati i ne gubiti vrijeme na njih. Poštene, empatične i logične osobe se trebaju okupiti, bez obzira na osobna uvjerenja i svjetonazore. Osim raskrinkavanja, dolazi vrijeme djelovanja brojnim i legalnim sredstvima u gospodarstvu, zdravlju, autonomiji… U protivnom, sve će nas porobiti.

Pitate se što učiniti nakon čitanja ovog teksta? Jednostavno, šaljite i dijelite tekst poštenim, empatičnim i logičnim osobama. Informirajte bližnje o postojanju portala Logično. Priključite nam se na našem Telegram kanalu tako što ćete kliknuti na Vijesti.  Od danas možete komunicirati i pisati nam u Telegram grupi Zajednica. Budimo složni, mudri i jaki.

Posjetite naš novi video kanal na platformi Odysee i obvezno se registrirajte, kao i najveću arhivu alternativnih video snimaka Jubitu.

Svidio vam se članak i
pitate se što možete napraviti?

*Stavovi izneseni u kolumnama su osobni stavovi autora i ne odražavaju nužno stav redakcije portala Logicno.com

Pretplati se
Zaštitite svoje ime u komentarima... REGISTRACIJA
212 Komentara
najnoviji najviše ocjenjeniji
Inline Feedbacks
View all comments
1 godina prije

Evidentno je da se radi o prevari epskih razmjera. I evidentno je da većina zagljupljene mase vjeruje mantrama kojima nas svakodnevno zasipaju mainstream mediji i medicinari.Kabala je odlučila da je došlo vrijeme za eutanaziju beskorisnih izjelica na planetu i bojim se da im nitko nće pomrsiti planove.

1 godina prije

I sad Vi poštovani komentatori objasnite koja je to koincidencija da Kina nije imala “drugi val” a možda je i prvi val bila prevara????? Tko je Trumpu dao savjet da prekine financiranje WHO? I zašto je odmah upro prstom na povezanost Kine i WHO-a???? Pa zar Wuhan i sve one… Pročitaj više »

1 godina prije

Nadam se da kovid-19 nije generalna proba za mogući kovid-21.

1 godina prije

Možete vi iznositi dokaze koliko hoćete, ali njihova agenda ide dalje. Sa njom nažalost idu i maltretiranja, kažnjavanja, ponižavanja, trovanja maskama, nedostupnost medicinske pomoći…… Minimum 95% ljudi (mada nisam siguran dali zaslužuju da ih se tako zove) djelomično ili u potpunosti vjeruje u cijelu priču i taj postotak se ne… Pročitaj više »

1 godina prije

Iluminati se igraju s’nama ko sa stokom sitnog zuba, i mi ništa ne poduzimamo.. nego izvodimo raznorazne interpretacije
njihova viđenja situacija… jadno i žalosno

1 godina prije

Sve je evidentno ali i dalje svi sutimo i oni guraju svoje

1 godina prije

Dobar članak.
Nadam se da će se pobornici “zlog virusa” malo smiriti sada.

1 godina prije

Ovo neće završiti bez krvoprolića.

Tupko Glupko
Tupko Glupko
1 godina prije

Zanimljivo da Kina de facto službeno skoro da i nema niti jednog mrtvog od Covid-19 još od travnja 2020.: China Coronavirus: 86,741 Cases and 4,634 Deaths – Worldometer (worldometers.info) Gospodari Kaosa očigledno su odlučili ekonomski izdići Kinu, a ostatak svijeta gospodarski uništiti svojim Covid-19 mjerama i uvesti politički ono što… Pročitaj više »

Legendarni Grk
Legendarni Grk
1 godina prije

Zapravo se ovdje radi o trovanju preko cjepiva, zraka (chemtrails), hrane i vode, a otkriveni otrovi (u chemtrails) su aluminij, barij, stroncij, osiromašeni uran, itd. U zadnje vrijeme su pojačali koncentracije tih otrova koje bacaju na ljude avionima, a poznato je da trovanje ide i preko hrane, vode i lijekova.… Pročitaj više »

1 godina prije

Svi znamo da je ovo prevara ali nitko ništa ne čini po tom pitanju!

Rocco Paic
Rocco Paic
1 godina prije

Pozivam redakciju portala Logicno da mom prijatelju koji ima 34 godine, a koji je bio potpuno zdrav do prije 15 dana objasni da je bolest kolokvijalno zvana korona prevara. Naime, taj moj prijatelj leži u bolnici, već dva dana je na respiratoru i upitno je hoće li preživjeti. Ako ga… Pročitaj više »

1 godina prije

Niste me slušali, a? Jel ja sve vreme pričam da nije SARS-CoV-2 nego SARS-CoV-3 a vi mi ne verujete? Kako da ga pronađu kad traže pogrešne registarske tablice??? A i ovi što su se razboleli i umrli – sve na psihološkoj bazi. Zar nije jedan od simptoma gubitak mirisa i… Pročitaj više »

1 godina prije

pa od čega onda ljudi umiru?

A neg.
A neg.
1 godina prije

Ukratko, virus nije uzrok bolesti.
Vezano uz tzv. Kochove postulate pročitajte Stefana Lanka

1 godina prije

Svi ti dokazi bili su jasni odavno.No sve je to đabe kada ljudi vjeruju medijima ovim glavnim i lete kao ovce na testiranje. Kada su vidjeli kako se dobro zarađuje na testiranjima normalno da su nastavili dalje.Dokle god ljudi ne shvate i prestanu se ici testirati do tda ce i… Pročitaj više »

1 godina prije

PCR test je od prilike kao da u kontejneru za stari papir prepunom printanih textova, sve iscijepano na sitne komadiće, tražite dokaz da je u njega bačeno jedno pismo printano na listu papira. Nađete neka slova od kojih bi traženo pismo moglo biti bar djelomično sastavljeno i tvrdite da je… Pročitaj više »

1 godina prije

“Treba suditi odgovornima za kazneno djelo zavjere radi počinjenja globalne prijevare. Ako budu proglašeni krivima, trebali bi biti zatvoreni, dok mi ostali nastavljamo s pokušajima popravljanja štete koju su već nanijeli.” AMEN!!

1 godina prije

To je zločin bez daljneg,

1 godina prije

Jebhe se virus za ovaj tekst, kao i za odluke stožera. On ide svojim putem. Uvijek treba razmotriti najjednostavniju opciju, pa tek onda one komplicirane. Kad bi neovisno o proturječnim informacijama što je svojstveno ratovima, promatrali stvarno stanje i posljedice onda bi najvjerojatnija i najjednostavnija opcija bila vođenje ograničenog biološkog… Pročitaj više »

1 godina prije

Otkad sam dosao sa broda,dva puta se prehladio.Jebiga,padne imunitet na brodu,pa se lakse kupi.Nijednom mi nije palo ici na testiranje,ne sljivim sugavi sistem.Neke bi panika uhvatila…

Bond, cigarete Bond
Bond, cigarete Bond
1 godina prije

Nego, preboli li iko ovu koronu sa portala? Moji ukućani i ja jesmo. Ćerka najmlađa imala 1 dan temp i glavobolju, Žena 2 dana glavobolja, temp a kašalje i nakon 10 dana. Leukociti niski, rtg pluća hmm, ima nešto. Umori se brzo. Nema mirisa ni okusa. Dobila danas sumamed. Ja… Pročitaj više »

1 godina prije

Psihijatri su najuspješniji među doktorima: njihovi pacijenti vladaju svijetom!

... ....
... ....
1 godina prije

Znači, ako uopće ima ičeg novog.. dok ekipa izrealizira neke svoje projekte koji zračenjem ugrožavaju one slabije trebaju neko opravdanje za to nastalo sr…

Legendarni Grk
Legendarni Grk
1 godina prije

Prirodni antibiotik Ovaj recept je prije nekoliko godina pomogao jednom starijem čovjeku od 83 godine kod trovanja hranom na nekom javnom okupljanju. Podmetnuli su im staru ribu i gotovo svi su završili u bolnici, dijagnoza HelicoBacter Pylori, Botulinus, teško trovanje probavnog sustava. Povraćao je nakon pola sata sve što bi… Pročitaj više »

1 godina prije

Kao da postoje 2 zaraze: jedan laki grip, a drugo – nešto bakterijski ili na bazi bojnog otrova sarina. Pa šta koga dopadne?

Nema Ime
Nema Ime
1 godina prije

Debeli Djuro je onaj supak is faktografa mad nemoze osporit onda trola

1 godina prije

Isti zaključak mogao bi napisati svaki iole pametniji majmun. Nije problem u smrtnosti jer je zaista mala, nego u zauzimanju bolničkih kapaciteta tako da ostali bolesnici, pogotovo kronični, ne mogu ni prismrditi bolnici več skoro 10 mjeseci.

